EMAIL THIS PAGE TO A FRIEND

BOK

BCL2-related ovarian killer

55 Gene Product Result for
Synonyms: BCL2L9 BOKL
UniProtKB ID: Q9UMX3
Gene ID:
Human(666) Summary: The protein encoded by this gene belongs to the BCL2 family, members of which form homo- or heterodimers, and act as anti- or proapoptotic regulators that are involved in a wide variety of cellular processes. Studies in rat show that this protein has restricted expression in reproductive tissues, interacts strongly with some antiapoptotic BCL2 proteins, not at all with proapoptotic BCL2 proteins, and induces apoptosis in transfected cells. Thus, this protein represents a proapoptotic member of the BCL2 family. [provided by RefSeq, Sep 2011]
Mouse(51800) BCL2-related ovarian killer protein
Rat(29884) BCL2-related ovarian killer
chicken(395445) BCL2-related ovarian killer
domestic cat(768266) BCL2-related ovarian killer
cow(504851) BCL2-related ovarian killer
naked mole-rat(101718555) BCL2-related ovarian killer
domestic guinea pig(100730838) BCL2-related ovarian killer
sheep(101122750) BCL2-related ovarian killer
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032515 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032515 Rosetta Predictions human pricing
NM_017312 Rosetta Predictions rat pricing
NM_016778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231429 predicted 726
2 SASI_Hs01_00231430 predicted 748
3 SASI_Hs01_00231431 predicted 764
4 SASI_Hs01_00231432 predicted 607
5 SASI_Hs01_00231433 predicted 980
6 SASI_Hs01_00231434 predicted 1104
7 SASI_Hs02_00360010 predicted 462
8 SASI_Hs01_00231435 predicted 285
9 SASI_Hs01_00231436 predicted 271
10 SASI_Hs01_00231437 predicted 259
11 SASI_Hs01_00231438 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261759 predicted 603
2 SASI_Rn01_00089451 predicted 318
3 SASI_Rn01_00089452 predicted 803
4 SASI_Rn01_00089453 predicted 794
5 SASI_Rn01_00089455 predicted 1101
6 SASI_Rn01_00089456 predicted 962
7 SASI_Rn01_00089457 predicted 951
8 SASI_Rn01_00089458 predicted 1060
9 SASI_Rn01_00089460 predicted 927
10 SASI_Rn02_00261760 predicted 880
11 SASI_Rn01_00089454 predicted 454
12 SASI_Rn01_00089459 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197490 predicted 1016
2 SASI_Mm01_00197491 predicted 423
3 SASI_Mm01_00197492 predicted 521
4 SASI_Mm01_00197493 predicted 546
5 SASI_Mm01_00197494 predicted 1178
6 SASI_Mm01_00197495 predicted 1094
7 SASI_Mm01_00197496 predicted 220
8 SASI_Mm01_00197497 predicted 913
9 SASI_Mm02_00323552 predicted 703
10 SASI_Mm01_00197499 predicted 1183
11 SASI_Mm01_00197498 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016778
VALIDATED
BOK MISSION shRNA Bacterial Glycerol Stock
BCL2-related ovarian killer
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-801s1c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-909s1c1
Sequence:CCGGCCTCACTCAAATTGGGAGCATCTCGAGATGCTCCCAATTTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-524s1c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-553s1c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-237s1c1
Sequence:CCGGGCCTTTGATCGCTCGCCCACACTCGAGTGTGGGCGAGCGATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016778.2-526s21c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-803s21c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-216s21c1
Sequence:CCGGTCTTTGCAGCGGAGATCATGGCTCGAGCCATGATCTCCGCTGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-1258s21c1
Sequence:CCGGAGCTTCTTGCTTAGGCTATTTCTCGAGAAATAGCCTAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-555s21c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016778
VALIDATED
BOK MISSION shRNA shRNA Plasmid DNA
BCL2-related ovarian killer
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-801s1c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-909s1c1
Sequence:CCGGCCTCACTCAAATTGGGAGCATCTCGAGATGCTCCCAATTTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-524s1c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-553s1c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-237s1c1
Sequence:CCGGGCCTTTGATCGCTCGCCCACACTCGAGTGTGGGCGAGCGATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016778.2-526s21c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-803s21c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-216s21c1
Sequence:CCGGTCTTTGCAGCGGAGATCATGGCTCGAGCCATGATCTCCGCTGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-1258s21c1
Sequence:CCGGAGCTTCTTGCTTAGGCTATTTCTCGAGAAATAGCCTAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-555s21c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016778
VALIDATED
BOK MISSION shRNA Lentiviral Transduction Particles
BCL2-related ovarian killer
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-801s1c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-909s1c1
Sequence:CCGGCCTCACTCAAATTGGGAGCATCTCGAGATGCTCCCAATTTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-524s1c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-553s1c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016778.1-237s1c1
Sequence:CCGGGCCTTTGATCGCTCGCCCACACTCGAGTGTGGGCGAGCGATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016778.2-526s21c1
Sequence:CCGGCCACATCTTCTCAGCAGGTATCTCGAGATACCTGCTGAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-803s21c1
Sequence:CCGGGCATTCTTCCTGTTGTTGCCACTCGAGTGGCAACAACAGGAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-216s21c1
Sequence:CCGGTCTTTGCAGCGGAGATCATGGCTCGAGCCATGATCTCCGCTGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-1258s21c1
Sequence:CCGGAGCTTCTTGCTTAGGCTATTTCTCGAGAAATAGCCTAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016778.2-555s21c1
Sequence:CCGGGCAAGGTAGTGTCCCTGTATTCTCGAGAATACAGGGACACTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032515
BOK MISSION shRNA Bacterial Glycerol Stock
BCL2-related ovarian killer
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000033539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032515.3-2295s1c1
Sequence:CCGGCGCCTACATTTCTAGGCACATCTCGAGATGTGCCTAGAAATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-280s1c1
Sequence:CCGGGCCGAGATCATGGACGCCTTTCTCGAGAAAGGCGTCCATGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-753s1c1
Sequence:CCGGCGGATGGACTGATGTCCTCAACTCGAGTTGAGGACATCAGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032515
BOK MISSION shRNA shRNA Plasmid DNA
BCL2-related ovarian killer
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000033539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032515.3-2295s1c1
Sequence:CCGGCGCCTACATTTCTAGGCACATCTCGAGATGTGCCTAGAAATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-280s1c1
Sequence:CCGGGCCGAGATCATGGACGCCTTTCTCGAGAAAGGCGTCCATGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-753s1c1
Sequence:CCGGCGGATGGACTGATGTCCTCAACTCGAGTTGAGGACATCAGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032515
BOK MISSION shRNA Lentiviral Transduction Particles
BCL2-related ovarian killer
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000033539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032515.3-2295s1c1
Sequence:CCGGCGCCTACATTTCTAGGCACATCTCGAGATGTGCCTAGAAATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-280s1c1
Sequence:CCGGGCCGAGATCATGGACGCCTTTCTCGAGAAAGGCGTCCATGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032515.3-753s1c1
Sequence:CCGGCGGATGGACTGATGTCCTCAACTCGAGTTGAGGACATCAGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks