EMAIL THIS PAGE TO A FRIEND

BOLA2

bolA family member 2

68 Gene Product Result for
Synonyms: BOLA2A My016
UniProtKB ID: Q9H3K6, A1L454, A7YDY3
Gene ID:
Human(552900) Summary: This gene is located within a region of a segmental duplication on chromosome 16p. The product of this gene belongs to the eukaryotic subfamily of the BolA-like proteins. This gene encodes the BolA-like protein 2. The BolA-like proteins are widely conserved from prokaryotes to eukaryotes, and these proteins seem to be involved in cell proliferation or cell-cycle regulation. [provided by RefSeq, Jul 2008]
Mouse(66162) bolA-like 2 (E. coli)
Rat(503208) bolA homolog 2 (E. coli)
Goat(100861028) bolA homolog 2 (E. coli)
Horse(100066237) bolA homolog 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031827 Rosetta Predictions human pricing
NM_001031833 Rosetta Predictions human pricing
XM_001073216 Rosetta Predictions rat pricing
XM_578733 Rosetta Predictions rat pricing
NM_175103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307827 predicted 724
2 SASI_Hs02_00307828 predicted 702
3 SASI_Hs02_00307829 predicted 718
4 SASI_Hs01_00066182 predicted 564
5 SASI_Hs02_00307830 predicted 721
6 SASI_Hs01_00066184 predicted 553
7 SASI_Hs02_00307831 predicted 776
8 SASI_Hs02_00307832 predicted 720
9 SASI_Hs02_00307833 predicted 708
10 SASI_Hs01_00066185 predicted 568
11 SASI_Hs01_00066177 predicted 620
12 SASI_Hs01_00066178 predicted 548
13 SASI_Hs01_00066179 predicted 571
14 SASI_Hs01_00066180 predicted 564
15 SASI_Hs01_00066181 predicted 614
16 SASI_Hs01_00066183 predicted 579
17 SASI_Hs01_00066186 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241096 predicted 616
2 SASI_Hs01_00241097 predicted 548
3 SASI_Hs01_00241098 predicted 576
4 SASI_Hs01_00241099 predicted 567
5 SASI_Hs01_00241100 predicted 618
6 SASI_Hs01_00241101 predicted 568
7 SASI_Hs01_00241102 predicted 578
8 SASI_Hs01_00241103 predicted 565
9 SASI_Hs01_00241104 predicted 579
10 SASI_Hs01_00241105 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341936 predicted 230
2 SASI_Rn02_00341937 predicted 250
3 SASI_Rn02_00341938 predicted 220
4 SASI_Rn02_00341939 predicted 226
5 SASI_Rn02_00341940 predicted 241
6 SASI_Rn02_00341941 predicted 224
7 SASI_Rn02_00341942 predicted 318
8 SASI_Rn02_00341943 predicted 308
9 SASI_Rn02_00341944 predicted 320
10 SASI_Rn02_00341945 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408266 predicted 231
2 SASI_Rn02_00408267 predicted 247
3 SASI_Rn02_00408268 predicted 224
4 SASI_Rn02_00408269 predicted 225
5 SASI_Rn02_00408270 predicted 243
6 SASI_Rn02_00408271 predicted 223
7 SASI_Rn02_00408272 predicted 312
8 SASI_Rn02_00408273 predicted 306
9 SASI_Rn02_00408274 predicted 320
10 SASI_Rn02_00408275 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151332 predicted 139
2 SASI_Mm01_00151334 predicted 299
3 SASI_Mm01_00151335 predicted 273
4 SASI_Mm01_00151336 predicted 182
5 SASI_Mm01_00151337 predicted 41
6 SASI_Mm01_00151338 predicted 49
7 SASI_Mm01_00151339 predicted 155
8 SASI_Mm02_00345701 predicted 224
9 SASI_Mm02_00345702 predicted 137
10 SASI_Mm01_00151340 predicted 202
11 SASI_Mm01_00151333 predicted 155
12 SASI_Mm01_00151341 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031833
BOLA2 MISSION shRNA Bacterial Glycerol Stock
bolA family member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031833.1-1240s1c1
Sequence:CCGGGCTTGAAGAATATTCCTGTTTCTCGAGAAACAGGAATATTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-575s1c1
Sequence:CCGGCGTTGACGTACGCCTTAGTAACTCGAGTTACTAAGGCGTACGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-859s1c1
Sequence:CCGGCTTCAGAGACACAGGTTCTGTCTCGAGACAGAACCTGTGTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031833
BOLA2 MISSION shRNA shRNA Plasmid DNA
bolA family member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031833.1-1240s1c1
Sequence:CCGGGCTTGAAGAATATTCCTGTTTCTCGAGAAACAGGAATATTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-575s1c1
Sequence:CCGGCGTTGACGTACGCCTTAGTAACTCGAGTTACTAAGGCGTACGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-859s1c1
Sequence:CCGGCTTCAGAGACACAGGTTCTGTCTCGAGACAGAACCTGTGTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031833
BOLA2 MISSION shRNA Lentiviral Transduction Particles
bolA family member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031833.1-1240s1c1
Sequence:CCGGGCTTGAAGAATATTCCTGTTTCTCGAGAAACAGGAATATTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-575s1c1
Sequence:CCGGCGTTGACGTACGCCTTAGTAACTCGAGTTACTAAGGCGTACGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031833.1-859s1c1
Sequence:CCGGCTTCAGAGACACAGGTTCTGTCTCGAGACAGAACCTGTGTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175103
VALIDATED
BOLA2 MISSION shRNA Bacterial Glycerol Stock
bolA family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-302s21c1
Sequence:CCGGGCCTAGGCCTGAACAGTCATTCTCGAGAATGACTGTTCAGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-205s21c1
Sequence:CCGGGAACGAGTGCTTAGCCGAAGACTCGAGTCTTCGGCTAAGCACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-236s21c1
Sequence:CCGGATCCATGCCTTTGAGCAGAAACTCGAGTTTCTGCTCAAAGGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-111s21c1
Sequence:CCGGACACGACTCTGAACCGTTGCGCTCGAGCGCAACGGTTCAGAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-157s21c1
Sequence:CCGGGTCGGCTAAGTTCGAGGGAAACTCGAGTTTCCCTCGAACTTAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175103
VALIDATED
BOLA2 MISSION shRNA shRNA Plasmid DNA
bolA family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-302s21c1
Sequence:CCGGGCCTAGGCCTGAACAGTCATTCTCGAGAATGACTGTTCAGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-205s21c1
Sequence:CCGGGAACGAGTGCTTAGCCGAAGACTCGAGTCTTCGGCTAAGCACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-236s21c1
Sequence:CCGGATCCATGCCTTTGAGCAGAAACTCGAGTTTCTGCTCAAAGGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-111s21c1
Sequence:CCGGACACGACTCTGAACCGTTGCGCTCGAGCGCAACGGTTCAGAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-157s21c1
Sequence:CCGGGTCGGCTAAGTTCGAGGGAAACTCGAGTTTCCCTCGAACTTAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175103
VALIDATED
BOLA2 MISSION shRNA Lentiviral Transduction Particles
bolA family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-302s21c1
Sequence:CCGGGCCTAGGCCTGAACAGTCATTCTCGAGAATGACTGTTCAGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-205s21c1
Sequence:CCGGGAACGAGTGCTTAGCCGAAGACTCGAGTCTTCGGCTAAGCACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-236s21c1
Sequence:CCGGATCCATGCCTTTGAGCAGAAACTCGAGTTTCTGCTCAAAGGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-111s21c1
Sequence:CCGGACACGACTCTGAACCGTTGCGCTCGAGCGCAACGGTTCAGAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175103.3-157s21c1
Sequence:CCGGGTCGGCTAAGTTCGAGGGAAACTCGAGTTTCCCTCGAACTTAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031827
BOLA2 MISSION shRNA Bacterial Glycerol Stock
bolA family member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-576s21c1
Sequence:CCGGGTTGACGTACGCCTTAGTAAGCTCGAGCTTACTAAGGCGTACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-615s21c1
Sequence:CCGGAGCGGAAGTGGCTCCTGTAAGCTCGAGCTTACAGGAGCCACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-565s21c1
Sequence:CCGGGGAAGTACTGCGTTGACGTACCTCGAGGTACGTCAACGCAGTACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-711s21c1
Sequence:CCGGCATGGAACTCAGCGCCGAATACTCGAGTATTCGGCGCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031827
BOLA2 MISSION shRNA shRNA Plasmid DNA
bolA family member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-576s21c1
Sequence:CCGGGTTGACGTACGCCTTAGTAAGCTCGAGCTTACTAAGGCGTACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-615s21c1
Sequence:CCGGAGCGGAAGTGGCTCCTGTAAGCTCGAGCTTACAGGAGCCACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-565s21c1
Sequence:CCGGGGAAGTACTGCGTTGACGTACCTCGAGGTACGTCAACGCAGTACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-711s21c1
Sequence:CCGGCATGGAACTCAGCGCCGAATACTCGAGTATTCGGCGCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031827
BOLA2 MISSION shRNA Lentiviral Transduction Particles
bolA family member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-576s21c1
Sequence:CCGGGTTGACGTACGCCTTAGTAAGCTCGAGCTTACTAAGGCGTACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-615s21c1
Sequence:CCGGAGCGGAAGTGGCTCCTGTAAGCTCGAGCTTACAGGAGCCACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-565s21c1
Sequence:CCGGGGAAGTACTGCGTTGACGTACCTCGAGGTACGTCAACGCAGTACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031827.1-711s21c1
Sequence:CCGGCATGGAACTCAGCGCCGAATACTCGAGTATTCGGCGCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks