EMAIL THIS PAGE TO A FRIEND

BOLA3

bolA family member 3

74 Gene Product Result for
Synonyms: MMDS2
UniProtKB ID: Q53S33, G3XAB0
Gene ID:
Human(388962) Summary: This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011]
Mouse(78653) bolA-like 3 (E. coli)
Rat(297388) bolA homolog 3 (E. coli)
naked mole-rat(101706962) bolA homolog 3 (E. coli)
domestic guinea pig(100715689) bolA homolog 3 (E. coli)
sheep(101115107) bolA homolog 3 (E. coli)
cow(614629) bolA homolog 3 (E. coli)
dog(612287) bolA homolog 3 (E. coli)
domestic cat(101099627) bolA homolog 3 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035505 Rosetta Predictions human pricing
NM_212552 Rosetta Predictions human pricing
NM_001106601 Rosetta Predictions rat pricing
NM_175277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145583 predicted 227
2 SASI_Hs01_00145584 predicted 233
3 SASI_Hs01_00145585 predicted 224
4 SASI_Hs01_00145586 predicted 232
5 SASI_Hs01_00145587 predicted 232
6 SASI_Hs01_00145588 predicted 224
7 SASI_Hs01_00145589 predicted 226
8 SASI_Hs01_00145590 predicted 231
9 SASI_Hs01_00145591 predicted 310
10 SASI_Hs01_00145592 predicted 130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159942 predicted 275
2 SASI_Hs01_00159943 predicted 279
3 SASI_Hs01_00159944 predicted 269
4 SASI_Hs01_00159945 predicted 266
5 SASI_Hs01_00159946 predicted 283
6 SASI_Hs01_00159947 predicted 266
7 SASI_Hs01_00159949 predicted 273
8 SASI_Hs01_00159950 predicted 237
9 SASI_Hs01_00159951 predicted 277
10 SASI_Hs02_00374230 predicted 271
11 SASI_Hs01_00159948 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220558 predicted 307
2 SASI_Rn02_00220559 predicted 610
3 SASI_Rn02_00220560 predicted 597
4 SASI_Rn02_00220561 predicted 589
5 SASI_Rn02_00220562 predicted 570
6 SASI_Rn02_00220563 predicted 234
7 SASI_Rn02_00220564 predicted 725
8 SASI_Rn02_00220565 predicted 277
9 SASI_Rn02_00220566 predicted 307
10 SASI_Rn02_00220567 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140507 predicted 303
2 SASI_Mm01_00140508 predicted 221
3 SASI_Mm01_00140509 predicted 264
4 SASI_Mm01_00140510 predicted 221
5 SASI_Mm01_00140511 predicted 269
6 SASI_Mm01_00140512 predicted 269
7 SASI_Mm01_00140513 predicted 296
8 SASI_Mm01_00140514 predicted 304
9 SASI_Mm01_00140515 predicted 224
10 SASI_Mm01_00140516 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212552
BOLA3 MISSION shRNA Bacterial Glycerol Stock
bolA family member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000352986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-144s21c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-318s21c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-167s21c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-279s21c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212552
BOLA3 MISSION shRNA shRNA Plasmid DNA
bolA family member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000352986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-144s21c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-318s21c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-167s21c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-279s21c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212552
BOLA3 MISSION shRNA Lentiviral Transduction Particles
bolA family member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000352986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-144s21c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-318s21c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-167s21c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212552.2-279s21c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175277
VALIDATED
BOLA3 MISSION shRNA Bacterial Glycerol Stock
bolA family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-272s21c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-225s21c1
Sequence:CCGGATCGAATCGGAAGAATTTAAACTCGAGTTTAAATTCTTCCGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-161s21c1
Sequence:CCGGTCGAGCCACAGCTATTCAAGTCTCGAGACTTGAATAGCTGTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.4-272s1c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-84s21c1
Sequence:CCGGCACTGTGCGCAGCGAATGTTTCTCGAGAAACATTCGCTGCGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-356s21c1
Sequence:CCGGGACTGACTGCTCACGCTTAAACTCGAGTTTAAGCGTGAGCAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-129s1c1
Sequence:CCGGCAAAGTGACCCAGGTTCTCAACTCGAGTTGAGAACCTGGGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-233s1c1
Sequence:CCGGCGGAAGAATTTAAAGAGAAGACTCGAGTCTTCTCTTTAAATTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175277
VALIDATED
BOLA3 MISSION shRNA shRNA Plasmid DNA
bolA family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-272s21c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-225s21c1
Sequence:CCGGATCGAATCGGAAGAATTTAAACTCGAGTTTAAATTCTTCCGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-161s21c1
Sequence:CCGGTCGAGCCACAGCTATTCAAGTCTCGAGACTTGAATAGCTGTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.4-272s1c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-84s21c1
Sequence:CCGGCACTGTGCGCAGCGAATGTTTCTCGAGAAACATTCGCTGCGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-356s21c1
Sequence:CCGGGACTGACTGCTCACGCTTAAACTCGAGTTTAAGCGTGAGCAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-129s1c1
Sequence:CCGGCAAAGTGACCCAGGTTCTCAACTCGAGTTGAGAACCTGGGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-233s1c1
Sequence:CCGGCGGAAGAATTTAAAGAGAAGACTCGAGTCTTCTCTTTAAATTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175277
VALIDATED
BOLA3 MISSION shRNA Lentiviral Transduction Particles
bolA family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-272s21c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-225s21c1
Sequence:CCGGATCGAATCGGAAGAATTTAAACTCGAGTTTAAATTCTTCCGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-161s21c1
Sequence:CCGGTCGAGCCACAGCTATTCAAGTCTCGAGACTTGAATAGCTGTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.4-272s1c1
Sequence:CCGGGATGGTCAATCAGGCACTAAACTCGAGTTTAGTGCCTGATTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-84s21c1
Sequence:CCGGCACTGTGCGCAGCGAATGTTTCTCGAGAAACATTCGCTGCGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175277.4-356s21c1
Sequence:CCGGGACTGACTGCTCACGCTTAAACTCGAGTTTAAGCGTGAGCAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-129s1c1
Sequence:CCGGCAAAGTGACCCAGGTTCTCAACTCGAGTTGAGAACCTGGGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175277.2-233s1c1
Sequence:CCGGCGGAAGAATTTAAAGAGAAGACTCGAGTCTTCTCTTTAAATTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371502
VALIDATED
BOLA3 MISSION shRNA Bacterial Glycerol Stock
bolA family member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-163s1c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371502.2-106s1c1
Sequence:CCGGGATGTTTGCCACTCAGACTGACTCGAGTCAGTCTGAGTGGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-140s1c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-275s1c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-370s1c1
Sequence:CCGGCTGCATAGATGCTGCTGCTTACTCGAGTAAGCAGCAGCATCTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-314s1c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371502
VALIDATED
BOLA3 MISSION shRNA shRNA Plasmid DNA
bolA family member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-163s1c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371502.2-106s1c1
Sequence:CCGGGATGTTTGCCACTCAGACTGACTCGAGTCAGTCTGAGTGGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-140s1c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-275s1c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-370s1c1
Sequence:CCGGCTGCATAGATGCTGCTGCTTACTCGAGTAAGCAGCAGCATCTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-314s1c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371502
VALIDATED
BOLA3 MISSION shRNA Lentiviral Transduction Particles
bolA family member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-163s1c1
Sequence:CCGGGTTTCCACGAGCTACAGCTATCTCGAGATAGCTGTAGCTCGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371502.2-106s1c1
Sequence:CCGGGATGTTTGCCACTCAGACTGACTCGAGTCAGTCTGAGTGGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-140s1c1
Sequence:CCGGGTGACCCAAATTCTCAAAGAACTCGAGTTCTTTGAGAATTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-275s1c1
Sequence:CCGGCACCAGATGGTTAATCAGGCACTCGAGTGCCTGATTAACCATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-370s1c1
Sequence:CCGGCTGCATAGATGCTGCTGCTTACTCGAGTAAGCAGCAGCATCTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371502.2-314s1c1
Sequence:CCGGGAGATGCATGGATTGCGGATACTCGAGTATCCGCAATCCATGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks