EMAIL THIS PAGE TO A FRIEND

BOLL

bol, boule-like (Drosophila)

Synonyms: BOULE
UniProtKB ID: Q8N9W6, Q0JW32, Q53T62, Q969U3
Gene ID:
Human(66037) Summary: This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(75388) bol, boule-like (Drosophila)
Rat(501143) bol, boule-like (Drosophila)
chicken(424061) bol, boule-like (Drosophila)
dog(488458) bol, boule-like (Drosophila)
cow(527841) bol, boule-like (Drosophila)
domestic cat(101089636) bol, boule-like (Drosophila)
sheep(101123609) bol, boule-like (Drosophila)
domestic guinea pig(100722129) bol, boule-like (Drosophila)
naked mole-rat(101702910) bol, boule-like (Drosophila)
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501911 Anti-BOLL (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, bovine
ELISA, immunohistochemistry pricing
HPA018678 Anti-BOLL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100219 Anti-BOLL antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, mouse, horse, human, rat, bovine
western blot pricing
HPA048813 Anti-BOLL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411299 Anti-BOLL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
WH0066037M1 Monoclonal Anti-BOLL antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409686 Monoclonal Anti-BOLL antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB1409687 Monoclonal Anti-BOLL antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409688 Monoclonal Anti-BOLL antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409689 Monoclonal Anti-BOLL antibody produced in mouse clone 2G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405262 Monoclonal Anti-BOLL, (C-terminal) antibody produced in mouse clone 5B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033030 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033030 Rosetta Predictions human pricing
NM_197970 Rosetta Predictions human pricing
NM_001113370 Rosetta Predictions rat pricing
NM_001113367 Rosetta Predictions mouse pricing
NM_029267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106248 predicted 683
2 SASI_Hs01_00106249 predicted 615
3 SASI_Hs01_00106250 predicted 1056
4 SASI_Hs01_00106251 predicted 693
5 SASI_Hs02_00360720 predicted 1185
6 SASI_Hs01_00106252 predicted 1238
7 SASI_Hs01_00106253 predicted 1035
8 SASI_Hs02_00360721 predicted 1188
9 SASI_Hs01_00106254 predicted 1257
10 SASI_Hs01_00106255 predicted 1173
11 SASI_Hs01_00106247 predicted 731
12 SASI_Hs01_00106256 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206115 predicted 618
2 SASI_Hs01_00206116 predicted 555
3 SASI_Hs01_00206117 predicted 1001
4 SASI_Hs01_00206118 predicted 631
5 SASI_Hs02_00371583 predicted 1120
6 SASI_Hs01_00206119 predicted 1173
7 SASI_Hs01_00206120 predicted 966
8 SASI_Hs02_00371584 predicted 1120
9 SASI_Hs01_00206121 predicted 1187
10 SASI_Hs01_00206122 predicted 1109
11 SASI_Hs01_00206114 predicted 664
12 SASI_Hs01_00206123 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251773 predicted 619
2 SASI_Rn02_00251774 predicted 593
3 SASI_Rn02_00251775 predicted 504
4 SASI_Rn02_00251776 predicted 686
5 SASI_Rn02_00251777 predicted 299
6 SASI_Rn02_00251778 predicted 408
7 SASI_Rn02_00251779 predicted 279
8 SASI_Rn02_00251780 predicted 378
9 SASI_Rn02_00251781 predicted 254
10 SASI_Rn02_00251782 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307528 predicted 640
2 SASI_Mm02_00307529 predicted 632
3 SASI_Mm02_00307530 predicted 639
4 SASI_Mm02_00307531 predicted 618
5 SASI_Mm02_00307532 predicted 660
6 SASI_Mm02_00307533 predicted 626
7 SASI_Mm02_00307534 predicted 607
8 SASI_Mm02_00307535 predicted 660
9 SASI_Mm02_00307536 predicted 711
10 SASI_Mm02_00307537 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335037 predicted 585
2 SASI_Mm02_00335038 predicted 492
3 SASI_Mm01_00042722 predicted 402
4 SASI_Mm02_00335039 predicted 570
5 SASI_Mm02_00335040 predicted 521
6 SASI_Mm02_00335041 predicted 489
7 SASI_Mm02_00335042 predicted 523
8 SASI_Mm02_00335043 predicted 605
9 SASI_Mm01_00042727 predicted 361
10 SASI_Mm02_00335044 predicted 590
11 SASI_Mm01_00042723 predicted 307
12 SASI_Mm01_00042724 predicted 277
13 SASI_Mm01_00042725 predicted 303
14 SASI_Mm01_00042726 predicted 353
15 SASI_Mm01_00042728 predicted 301
16 SASI_Mm01_00042729 predicted 343
17 SASI_Mm01_00042730 predicted 295
18 SASI_Mm01_00042731 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033030
BOLL MISSION shRNA Bacterial Glycerol Stock
bol, boule-like (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-1064s1c1
Sequence:CCGGGCAACATATCACCAGGTTTATCTCGAGATAAACCTGGTGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-354s1c1
Sequence:CCGGCTGTGCCTTTGAATAACCCAACTCGAGTTGGGTTATTCAAAGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033030.3-1257s1c1
Sequence:CCGGCCCGTTGTGAAACTTAGTGTTCTCGAGAACACTAAGTTTCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-515s1c1
Sequence:CCGGGCTGGAGTATCCAAAGGGTATCTCGAGATACCCTTTGGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-1116s21c1
Sequence:CCGGTGATGCAGCCTGAGCCAATTACTCGAGTAATTGGCTCAGGCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-704s21c1
Sequence:CCGGACTTCAACTGGATATCCTTATCTCGAGATAAGGATATCCAGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033030
BOLL MISSION shRNA shRNA Plasmid DNA
bol, boule-like (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-1064s1c1
Sequence:CCGGGCAACATATCACCAGGTTTATCTCGAGATAAACCTGGTGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-354s1c1
Sequence:CCGGCTGTGCCTTTGAATAACCCAACTCGAGTTGGGTTATTCAAAGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033030.3-1257s1c1
Sequence:CCGGCCCGTTGTGAAACTTAGTGTTCTCGAGAACACTAAGTTTCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-515s1c1
Sequence:CCGGGCTGGAGTATCCAAAGGGTATCTCGAGATACCCTTTGGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-1116s21c1
Sequence:CCGGTGATGCAGCCTGAGCCAATTACTCGAGTAATTGGCTCAGGCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-704s21c1
Sequence:CCGGACTTCAACTGGATATCCTTATCTCGAGATAAGGATATCCAGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033030
BOLL MISSION shRNA Lentiviral Transduction Particles
bol, boule-like (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-1064s1c1
Sequence:CCGGGCAACATATCACCAGGTTTATCTCGAGATAAACCTGGTGATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-354s1c1
Sequence:CCGGCTGTGCCTTTGAATAACCCAACTCGAGTTGGGTTATTCAAAGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033030.3-1257s1c1
Sequence:CCGGCCCGTTGTGAAACTTAGTGTTCTCGAGAACACTAAGTTTCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033030.3-515s1c1
Sequence:CCGGGCTGGAGTATCCAAAGGGTATCTCGAGATACCCTTTGGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-1116s21c1
Sequence:CCGGTGATGCAGCCTGAGCCAATTACTCGAGTAATTGGCTCAGGCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033030.5-704s21c1
Sequence:CCGGACTTCAACTGGATATCCTTATCTCGAGATAAGGATATCCAGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029267
BOLL MISSION shRNA Bacterial Glycerol Stock
bol, boule-like (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-287s1c1
Sequence:CCGGCGCATCTTTGTAGGAGGAATTCTCGAGAATTCCTCCTACAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-495s1c1
Sequence:CCGGTCAACATTGGTCCAGCAATAACTCGAGTTATTGCTGGACCAATGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-346s1c1
Sequence:CCGGCTCCCAATATGGGTCTGTAAACTCGAGTTTACAGACCCATATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-392s1c1
Sequence:CCGGGCTGGAGTGTCCAAAGGGTATCTCGAGATACCCTTTGGACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-259s1c1
Sequence:CCGGCCCAAGATACGGAACTGTGATCTCGAGATCACAGTTCCGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029267
BOLL MISSION shRNA shRNA Plasmid DNA
bol, boule-like (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-287s1c1
Sequence:CCGGCGCATCTTTGTAGGAGGAATTCTCGAGAATTCCTCCTACAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-495s1c1
Sequence:CCGGTCAACATTGGTCCAGCAATAACTCGAGTTATTGCTGGACCAATGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-346s1c1
Sequence:CCGGCTCCCAATATGGGTCTGTAAACTCGAGTTTACAGACCCATATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-392s1c1
Sequence:CCGGGCTGGAGTGTCCAAAGGGTATCTCGAGATACCCTTTGGACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-259s1c1
Sequence:CCGGCCCAAGATACGGAACTGTGATCTCGAGATCACAGTTCCGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029267
BOLL MISSION shRNA Lentiviral Transduction Particles
bol, boule-like (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-287s1c1
Sequence:CCGGCGCATCTTTGTAGGAGGAATTCTCGAGAATTCCTCCTACAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-495s1c1
Sequence:CCGGTCAACATTGGTCCAGCAATAACTCGAGTTATTGCTGGACCAATGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-346s1c1
Sequence:CCGGCTCCCAATATGGGTCTGTAAACTCGAGTTTACAGACCCATATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-392s1c1
Sequence:CCGGGCTGGAGTGTCCAAAGGGTATCTCGAGATACCCTTTGGACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029267.1-259s1c1
Sequence:CCGGCCCAAGATACGGAACTGTGATCTCGAGATCACAGTTCCGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks