EMAIL THIS PAGE TO A FRIEND

BOP1

block of proliferation 1

52 Gene Product Result for
UniProtKB ID: Q14137, Q969Z6, Q96IS8, Q9BSA7, Q9BVM0
Gene ID:
Mouse(12181) block of proliferation 1
Rat(300050) block of proliferation 1
Zebrafish(777627) block of proliferation 1
chicken(425985) block of proliferation 1
Thale Cress(824880) protein BLADE ON PETIOLE 1
dog(100685748) block of proliferation 1
Horse(100065050) block of proliferation 1
cow(515056) block of proliferation 1
domestic cat(101095471) block of proliferation 1
sheep(101109624) block of proliferation 1
naked mole-rat(101724596) block of proliferation 1
domestic guinea pig(100733291) block of proliferation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015201 Rosetta Predictions human pricing
NM_001024250 Rosetta Predictions rat pricing
NM_013481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156981 predicted 1300
2 SASI_Hs01_00156982 predicted 1015
3 SASI_Hs01_00156983 predicted 379
4 SASI_Hs01_00156984 predicted 833
5 SASI_Hs01_00156985 predicted 2122
6 SASI_Hs01_00156986 predicted 2027
7 SASI_Hs01_00156987 predicted 1997
8 SASI_Hs01_00156988 predicted 1199
9 SASI_Hs01_00156989 predicted 484
10 SASI_Hs01_00156990 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118006 predicted 1101
2 SASI_Rn01_00118007 predicted 1014
3 SASI_Rn01_00118008 predicted 379
4 SASI_Rn01_00118009 predicted 724
5 SASI_Rn02_00202409 predicted 1887
6 SASI_Rn01_00118010 predicted 744
7 SASI_Rn01_00118011 predicted 962
8 SASI_Rn01_00118012 predicted 1799
9 SASI_Rn01_00118013 predicted 1545
10 SASI_Rn01_00118014 predicted 2194
11 SASI_Rn01_00118015 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322119 predicted 1015
2 SASI_Mm01_00115397 predicted 580
3 SASI_Mm01_00115398 predicted 640
4 SASI_Mm01_00115399 predicted 1166
5 SASI_Mm01_00115400 predicted 1343
6 SASI_Mm01_00115401 predicted 1057
7 SASI_Mm01_00115403 predicted 2063
8 SASI_Mm01_00115404 predicted 1088
9 SASI_Mm01_00115405 predicted 1914
10 SASI_Mm01_00115406 predicted 1129
11 SASI_Mm01_00115402 predicted 1924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015201
VALIDATED
BOP1 MISSION shRNA Bacterial Glycerol Stock
block of proliferation 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-271s21c1
Sequence:CCGGGTGACAGCAGTGAGGATGATGCTCGAGCATCATCCTCACTGCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-2137s21c1
Sequence:CCGGGCCATGGCATGGTGTACAATGCTCGAGCATTGTACACCATGCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-1957s21c1
Sequence:CCGGCTGCAGGTGACAACGTCATCTCTCGAGAGATGACGTTGTCACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-332s21c1
Sequence:CCGGCGAGGGCCACAGTGGGATTAACTCGAGTTAATCCCACTGTGGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-2001s1c2
Sequence:CCGGGTGTGGTTTGACCTGGATCTTCTCGAGAAGATCCAGGTCAAACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-242s21c1
Sequence:CCGGTGTGTTCTCAGGCCTGGAAGACTCGAGTCTTCCAGGCCTGAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-451s21c1
Sequence:CCGGATGAGGAGGACATCCGGAACACTCGAGTGTTCCGGATGTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-229s21c1
Sequence:CCGGACAGCGAGGAGAGTGTGTTCTCTCGAGAGAACACACTCTCCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-488s1c1
Sequence:CCGGCTTGGAGTGGTACGATGACTTCTCGAGAAGTCATCGTACCACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-1194s1c1
Sequence:CCGGCAGCGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-951s1c1
Sequence:CCGGCGCCACAAGATGCACGTACCTCTCGAGAGGTACGTGCATCTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-1989s1c1
Sequence:CCGGGATAGCAAGCTGGTGTGGTTTCTCGAGAAACCACACCAGCTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015201
VALIDATED
BOP1 MISSION shRNA shRNA Plasmid DNA
block of proliferation 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-271s21c1
Sequence:CCGGGTGACAGCAGTGAGGATGATGCTCGAGCATCATCCTCACTGCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-2137s21c1
Sequence:CCGGGCCATGGCATGGTGTACAATGCTCGAGCATTGTACACCATGCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-1957s21c1
Sequence:CCGGCTGCAGGTGACAACGTCATCTCTCGAGAGATGACGTTGTCACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-332s21c1
Sequence:CCGGCGAGGGCCACAGTGGGATTAACTCGAGTTAATCCCACTGTGGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-2001s1c2
Sequence:CCGGGTGTGGTTTGACCTGGATCTTCTCGAGAAGATCCAGGTCAAACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-242s21c1
Sequence:CCGGTGTGTTCTCAGGCCTGGAAGACTCGAGTCTTCCAGGCCTGAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-451s21c1
Sequence:CCGGATGAGGAGGACATCCGGAACACTCGAGTGTTCCGGATGTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-229s21c1
Sequence:CCGGACAGCGAGGAGAGTGTGTTCTCTCGAGAGAACACACTCTCCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-488s1c1
Sequence:CCGGCTTGGAGTGGTACGATGACTTCTCGAGAAGTCATCGTACCACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-1194s1c1
Sequence:CCGGCAGCGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-951s1c1
Sequence:CCGGCGCCACAAGATGCACGTACCTCTCGAGAGGTACGTGCATCTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-1989s1c1
Sequence:CCGGGATAGCAAGCTGGTGTGGTTTCTCGAGAAACCACACCAGCTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015201
VALIDATED
BOP1 MISSION shRNA Lentiviral Transduction Particles
block of proliferation 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-271s21c1
Sequence:CCGGGTGACAGCAGTGAGGATGATGCTCGAGCATCATCCTCACTGCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015201.3-2137s21c1
Sequence:CCGGGCCATGGCATGGTGTACAATGCTCGAGCATTGTACACCATGCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-1957s21c1
Sequence:CCGGCTGCAGGTGACAACGTCATCTCTCGAGAGATGACGTTGTCACCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-332s21c1
Sequence:CCGGCGAGGGCCACAGTGGGATTAACTCGAGTTAATCCCACTGTGGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-2001s1c2
Sequence:CCGGGTGTGGTTTGACCTGGATCTTCTCGAGAAGATCCAGGTCAAACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-242s21c1
Sequence:CCGGTGTGTTCTCAGGCCTGGAAGACTCGAGTCTTCCAGGCCTGAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-451s21c1
Sequence:CCGGATGAGGAGGACATCCGGAACACTCGAGTGTTCCGGATGTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015201.3-229s21c1
Sequence:CCGGACAGCGAGGAGAGTGTGTTCTCTCGAGAGAACACACTCTCCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-488s1c1
Sequence:CCGGCTTGGAGTGGTACGATGACTTCTCGAGAAGTCATCGTACCACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015201.3-1194s1c1
Sequence:CCGGCAGCGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-951s1c1
Sequence:CCGGCGCCACAAGATGCACGTACCTCTCGAGAGGTACGTGCATCTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015201.3-1989s1c1
Sequence:CCGGGATAGCAAGCTGGTGTGGTTTCTCGAGAAACCACACCAGCTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013481
VALIDATED
BOP1 MISSION shRNA Bacterial Glycerol Stock
block of proliferation 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-2291s21c1
Sequence:CCGGCTCCACACAGAATCCTCAATACTCGAGTATTGAGGATTCTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-736s21c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1927s21c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1132s21c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-639s21c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1927s1c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1132s1c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-426s1c1
Sequence:CCGGCCTGGCATGGTACGATGAATTCTCGAGAATTCATCGTACCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-639s1c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-736s1c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013481
VALIDATED
BOP1 MISSION shRNA shRNA Plasmid DNA
block of proliferation 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-2291s21c1
Sequence:CCGGCTCCACACAGAATCCTCAATACTCGAGTATTGAGGATTCTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-736s21c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1927s21c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1132s21c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-639s21c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1927s1c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1132s1c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-426s1c1
Sequence:CCGGCCTGGCATGGTACGATGAATTCTCGAGAATTCATCGTACCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-639s1c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-736s1c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013481
VALIDATED
BOP1 MISSION shRNA Lentiviral Transduction Particles
block of proliferation 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-2291s21c1
Sequence:CCGGCTCCACACAGAATCCTCAATACTCGAGTATTGAGGATTCTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-736s21c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1927s21c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-1132s21c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013481.1-639s21c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1927s1c1
Sequence:CCGGGACAGCAAACTGGTGTGGTTTCTCGAGAAACCACACCAGTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-1132s1c1
Sequence:CCGGCAACGCAAGATGAGGGTGAATCTCGAGATTCACCCTCATCTTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-426s1c1
Sequence:CCGGCCTGGCATGGTACGATGAATTCTCGAGAATTCATCGTACCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-639s1c1
Sequence:CCGGGTTCGGAGATTCAGGCTTCAACTCGAGTTGAAGCCTGAATCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013481.1-736s1c1
Sequence:CCGGCGTAGTTTCATCCCATCCCTACTCGAGTAGGGATGGGATGAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks