EMAIL THIS PAGE TO A FRIEND

BORA

bora, aurora kinase A activator

54 Gene Product Result for
Synonyms: C13orf34
UniProtKB ID: Q6PGQ7, Q5W0P3, Q5W0P4, Q86YC6, Q96IW9, Q9H640
Gene ID:
Human(79866) Summary: BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]
Mouse(77744) bora, aurora kinase A activator
Rat(306102) bora, aurora kinase A activator
Zebrafish(555606) bora, aurora kinase A activator
chicken(769298) bora, aurora kinase A activator
fruit fly(40031) aurora borealis
dog(476944) bora, aurora kinase A activator
cow(514162) bora, aurora kinase A activator
domestic cat(101084413) bora, aurora kinase A activator
domestic guinea pig(100732514) bora, aurora kinase A activator
naked mole-rat(101723564) bora, aurora kinase A activator
sheep(101122704) bora, aurora kinase A activator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500025 Anti-BORA antibody produced in rabbit affinity isolated antibody, buffered aqueous solution, ab1 mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB3500030 Anti-BORA antibody produced in rabbit affinity isolated antibody, buffered aqueous solution, ab2 human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA040866 Anti-BORA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024808 Rosetta Predictions human pricing
NM_001013997 Rosetta Predictions rat pricing
NM_175265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357353 predicted 1101
2 SASI_Hs01_00162917 predicted 1123
3 SASI_Hs01_00162919 predicted 1030
4 SASI_Hs01_00162921 predicted 498
5 SASI_Hs01_00162922 predicted 291
6 SASI_Hs01_00162923 predicted 873
7 SASI_Hs01_00162924 predicted 1269
8 SASI_Hs01_00162925 predicted 272
9 SASI_Hs02_00357354 predicted 1137
10 SASI_Hs02_00357355 predicted 1260
11 SASI_Hs01_00162916 predicted 1374
12 SASI_Hs01_00162918 predicted 1485
13 SASI_Hs01_00162920 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059905 predicted 1657
2 SASI_Rn01_00059906 predicted 377
3 SASI_Rn02_00201356 predicted 1693
4 SASI_Rn01_00059907 predicted 1764
5 SASI_Rn01_00059908 predicted 1481
6 SASI_Rn01_00059909 predicted 766
7 SASI_Rn01_00059910 predicted 1760
8 SASI_Rn01_00059911 predicted 1230
9 SASI_Rn01_00059912 predicted 1213
10 SASI_Rn01_00059913 predicted 767
11 SASI_Rn01_00059914 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108636 predicted 559
2 SASI_Mm01_00108637 predicted 741
3 SASI_Mm01_00108638 predicted 1589
4 SASI_Mm01_00108639 predicted 471
5 SASI_Mm02_00345981 predicted 514
6 SASI_Mm01_00108641 predicted 1524
7 SASI_Mm01_00108643 predicted 1588
8 SASI_Mm02_00345982 predicted 568
9 SASI_Mm02_00345983 predicted 1210
10 SASI_Mm02_00345984 predicted 1107
11 SASI_Mm01_00108634 predicted 1732
12 SASI_Mm01_00108635 predicted 1734
13 SASI_Mm01_00108640 predicted 1713
14 SASI_Mm01_00108642 predicted 1709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024808
BORA MISSION shRNA Bacterial Glycerol Stock
bora, aurora kinase A activator
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-763s1c1
Sequence:CCGGGTCCTCACAGTGGTGTTCAAACTCGAGTTTGAACACCACTGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1906s1c1
Sequence:CCGGGCTTAGCTTTCCCTCCTTAATCTCGAGATTAAGGAGGGAAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-1059s1c1
Sequence:CCGGCCGTGTATCAGAAGTCCTTATCTCGAGATAAGGACTTCTGATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2341s1c1
Sequence:CCGGCCAGTGATAACTGTTCTAGTTCTCGAGAACTAGAACAGTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-645s1c1
Sequence:CCGGGCTGATGAATTTGCAGATCAACTCGAGTTGATCTGCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-276s1c1
Sequence:CCGGCCAGGGAAATTTAGATGGTCTCTCGAGAGACCATCTAAATTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1827s1c1
Sequence:CCGGGCTTAAGAGTTCCTCGCATATCTCGAGATATGCGAGGAACTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137856    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2076s1c1
Sequence:CCGGGCTCCTATCTTACAGGGTCAACTCGAGTTGACCCTGTAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-545s1c1
Sequence:CCGGGCTGACCATTCATTCTGAGAACTCGAGTTCTCAGAATGAATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-929s1c1
Sequence:CCGGGCCTATTTCTTCACCCACTTTCTCGAGAAAGTGGGTGAAGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-569s1c1
Sequence:CCGGCGATGCTGCTTGTCAGACATTCTCGAGAATGTCTGACAAGCAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024808
BORA MISSION shRNA shRNA Plasmid DNA
bora, aurora kinase A activator
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-763s1c1
Sequence:CCGGGTCCTCACAGTGGTGTTCAAACTCGAGTTTGAACACCACTGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1906s1c1
Sequence:CCGGGCTTAGCTTTCCCTCCTTAATCTCGAGATTAAGGAGGGAAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-1059s1c1
Sequence:CCGGCCGTGTATCAGAAGTCCTTATCTCGAGATAAGGACTTCTGATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2341s1c1
Sequence:CCGGCCAGTGATAACTGTTCTAGTTCTCGAGAACTAGAACAGTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-645s1c1
Sequence:CCGGGCTGATGAATTTGCAGATCAACTCGAGTTGATCTGCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-276s1c1
Sequence:CCGGCCAGGGAAATTTAGATGGTCTCTCGAGAGACCATCTAAATTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1827s1c1
Sequence:CCGGGCTTAAGAGTTCCTCGCATATCTCGAGATATGCGAGGAACTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137856    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2076s1c1
Sequence:CCGGGCTCCTATCTTACAGGGTCAACTCGAGTTGACCCTGTAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-545s1c1
Sequence:CCGGGCTGACCATTCATTCTGAGAACTCGAGTTCTCAGAATGAATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-929s1c1
Sequence:CCGGGCCTATTTCTTCACCCACTTTCTCGAGAAAGTGGGTGAAGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-569s1c1
Sequence:CCGGCGATGCTGCTTGTCAGACATTCTCGAGAATGTCTGACAAGCAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024808
BORA MISSION shRNA Lentiviral Transduction Particles
bora, aurora kinase A activator
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-763s1c1
Sequence:CCGGGTCCTCACAGTGGTGTTCAAACTCGAGTTTGAACACCACTGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1906s1c1
Sequence:CCGGGCTTAGCTTTCCCTCCTTAATCTCGAGATTAAGGAGGGAAAGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-1059s1c1
Sequence:CCGGCCGTGTATCAGAAGTCCTTATCTCGAGATAAGGACTTCTGATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2341s1c1
Sequence:CCGGCCAGTGATAACTGTTCTAGTTCTCGAGAACTAGAACAGTTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-645s1c1
Sequence:CCGGGCTGATGAATTTGCAGATCAACTCGAGTTGATCTGCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-276s1c1
Sequence:CCGGCCAGGGAAATTTAGATGGTCTCTCGAGAGACCATCTAAATTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024808.2-1827s1c1
Sequence:CCGGGCTTAAGAGTTCCTCGCATATCTCGAGATATGCGAGGAACTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137856    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024808.2-2076s1c1
Sequence:CCGGGCTCCTATCTTACAGGGTCAACTCGAGTTGACCCTGTAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-545s1c1
Sequence:CCGGGCTGACCATTCATTCTGAGAACTCGAGTTCTCAGAATGAATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024808.2-929s1c1
Sequence:CCGGGCCTATTTCTTCACCCACTTTCTCGAGAAAGTGGGTGAAGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024808.2-569s1c1
Sequence:CCGGCGATGCTGCTTGTCAGACATTCTCGAGAATGTCTGACAAGCAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175265
VALIDATED
BORA MISSION shRNA Bacterial Glycerol Stock
bora, aurora kinase A activator
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1791s1c1
Sequence:CCGGCCCTTTGAAGTGGAAATGAAACTCGAGTTTCATTTCCACTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1672s1c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-434s1c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175265.2-2016s1c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175265.2-1924s1c1
Sequence:CCGGGCGAGTTAGTGTGATGCTGATCTCGAGATCAGCATCACACTAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1591s1c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-433s21c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-391s1c1
Sequence:CCGGCTTTGAAAGTCCCAGTGATTACTCGAGTAATCACTGGGACTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-687s1c1
Sequence:CCGGCAGAGCTTCATCCCAGTAAATCTCGAGATTTACTGGGATGAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1590s21c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1671s21c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175265.4-2015s21c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175265
VALIDATED
BORA MISSION shRNA shRNA Plasmid DNA
bora, aurora kinase A activator
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1791s1c1
Sequence:CCGGCCCTTTGAAGTGGAAATGAAACTCGAGTTTCATTTCCACTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1672s1c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-434s1c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175265.2-2016s1c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175265.2-1924s1c1
Sequence:CCGGGCGAGTTAGTGTGATGCTGATCTCGAGATCAGCATCACACTAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1591s1c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-433s21c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-391s1c1
Sequence:CCGGCTTTGAAAGTCCCAGTGATTACTCGAGTAATCACTGGGACTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-687s1c1
Sequence:CCGGCAGAGCTTCATCCCAGTAAATCTCGAGATTTACTGGGATGAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1590s21c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1671s21c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175265.4-2015s21c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175265
VALIDATED
BORA MISSION shRNA Lentiviral Transduction Particles
bora, aurora kinase A activator
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1791s1c1
Sequence:CCGGCCCTTTGAAGTGGAAATGAAACTCGAGTTTCATTTCCACTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1672s1c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-434s1c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175265.2-2016s1c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175265.2-1924s1c1
Sequence:CCGGGCGAGTTAGTGTGATGCTGATCTCGAGATCAGCATCACACTAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175265.2-1591s1c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-433s21c1
Sequence:CCGGCCTTGCTAGTCCTTCTATCTTCTCGAGAAGATAGAAGGACTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-391s1c1
Sequence:CCGGCTTTGAAAGTCCCAGTGATTACTCGAGTAATCACTGGGACTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175265.4-687s1c1
Sequence:CCGGCAGAGCTTCATCCCAGTAAATCTCGAGATTTACTGGGATGAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1590s21c1
Sequence:CCGGCGAGTGGAATTGCCTTCAGTACTCGAGTACTGAAGGCAATTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175265.4-1671s21c1
Sequence:CCGGGCAGTGCTATCCAGATGAATACTCGAGTATTCATCTGGATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175265.4-2015s21c1
Sequence:CCGGGACCAGAAACTCCAAGTTGTTCTCGAGAACAACTTGGAGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks