EMAIL THIS PAGE TO A FRIEND

BPESC1

blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding)

78 Gene Product Result for
Synonyms: NCRNA00187
Species: Human BPESC1(60467)
UniProtKB ID: Q9GZL8, Q0VDG2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021812
BPESC1 MISSION shRNA Bacterial Glycerol Stock
blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-387s1c1
Sequence:CCGGGCATACCTTCTTTATCCCTTTCTCGAGAAAGGGATAAAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-382s1c1
Sequence:CCGGCCTTTGCATACCTTCTTTATCCTCGAGGATAAAGAAGGTATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-456s1c1
Sequence:CCGGCGAGAAACACGATTTGCAGGACTCGAGTCCTGCAAATCGTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-457s1c1
Sequence:CCGGGAGAAACACGATTTGCAGGACCTCGAGGTCCTGCAAATCGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-375s1c1
Sequence:CCGGCCCATATCCTTTGCATACCTTCTCGAGAAGGTATGCAAAGGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-376s1c1
Sequence:CCGGCCATATCCTTTGCATACCTTCCTCGAGGAAGGTATGCAAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-441s1c1
Sequence:CCGGGATACCATCAGACAACGAGAACTCGAGTTCTCGTTGTCTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-628s1c1
Sequence:CCGGGATTTCTTTGAGCTCCAGCTTCTCGAGAAGCTGGAGCTCAAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-617s1c1
Sequence:CCGGGTCCTTGGGTTGATTTCTTTGCTCGAGCAAAGAAATCAACCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-435s1c1
Sequence:CCGGGCTTGGGATACCATCAGACAACTCGAGTTGTCTGATGGTATCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021812
BPESC1 MISSION shRNA shRNA Plasmid DNA
blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-387s1c1
Sequence:CCGGGCATACCTTCTTTATCCCTTTCTCGAGAAAGGGATAAAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-382s1c1
Sequence:CCGGCCTTTGCATACCTTCTTTATCCTCGAGGATAAAGAAGGTATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-456s1c1
Sequence:CCGGCGAGAAACACGATTTGCAGGACTCGAGTCCTGCAAATCGTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-457s1c1
Sequence:CCGGGAGAAACACGATTTGCAGGACCTCGAGGTCCTGCAAATCGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-375s1c1
Sequence:CCGGCCCATATCCTTTGCATACCTTCTCGAGAAGGTATGCAAAGGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-376s1c1
Sequence:CCGGCCATATCCTTTGCATACCTTCCTCGAGGAAGGTATGCAAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-441s1c1
Sequence:CCGGGATACCATCAGACAACGAGAACTCGAGTTCTCGTTGTCTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-628s1c1
Sequence:CCGGGATTTCTTTGAGCTCCAGCTTCTCGAGAAGCTGGAGCTCAAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-617s1c1
Sequence:CCGGGTCCTTGGGTTGATTTCTTTGCTCGAGCAAAGAAATCAACCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-435s1c1
Sequence:CCGGGCTTGGGATACCATCAGACAACTCGAGTTGTCTGATGGTATCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021812
BPESC1 MISSION shRNA Lentiviral Transduction Particles
blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-387s1c1
Sequence:CCGGGCATACCTTCTTTATCCCTTTCTCGAGAAAGGGATAAAGAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-382s1c1
Sequence:CCGGCCTTTGCATACCTTCTTTATCCTCGAGGATAAAGAAGGTATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-456s1c1
Sequence:CCGGCGAGAAACACGATTTGCAGGACTCGAGTCCTGCAAATCGTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-457s1c1
Sequence:CCGGGAGAAACACGATTTGCAGGACCTCGAGGTCCTGCAAATCGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-375s1c1
Sequence:CCGGCCCATATCCTTTGCATACCTTCTCGAGAAGGTATGCAAAGGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-376s1c1
Sequence:CCGGCCATATCCTTTGCATACCTTCCTCGAGGAAGGTATGCAAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-441s1c1
Sequence:CCGGGATACCATCAGACAACGAGAACTCGAGTTCTCGTTGTCTGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021812.1-628s1c1
Sequence:CCGGGATTTCTTTGAGCTCCAGCTTCTCGAGAAGCTGGAGCTCAAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-617s1c1
Sequence:CCGGGTCCTTGGGTTGATTTCTTTGCTCGAGCAAAGAAATCAACCCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021812.1-435s1c1
Sequence:CCGGGCTTGGGATACCATCAGACAACTCGAGTTGTCTGATGGTATCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks