EMAIL THIS PAGE TO A FRIEND

BPGM

2,3-bisphosphoglycerate mutase

76 Gene Product Result for
Synonyms: DPGM
UniProtKB ID: P07738, A4D1N9
Gene ID:
Human(669) Summary: 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Mouse(12183) 2,3-bisphosphoglycerate mutase
Rat(296973) 2,3-bisphosphoglycerate mutase
Zebrafish(436903) 2,3-bisphosphoglycerate mutase
dog(482704) 2,3-bisphosphoglycerate mutase
domestic cat(101095644) 2,3-bisphosphoglycerate mutase
cow(533785) 2,3-bisphosphoglycerate mutase
chicken(418172) 2,3-bisphosphoglycerate mutase
domestic guinea pig(100722842) 2,3-bisphosphoglycerate mutase
naked mole-rat(101706859) 2,3-bisphosphoglycerate mutase
sheep(101121089) 2,3-bisphosphoglycerate mutase
Domestic Rabbit(100009096) 2,3-bisphosphoglycerate mutase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001724 Rosetta Predictions human pricing
NM_199186 Rosetta Predictions human pricing
NM_199382 Rosetta Predictions rat pricing
NM_007563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093859 predicted 720
2 SASI_Hs01_00093860 predicted 975
3 SASI_Hs01_00093862 predicted 840
4 SASI_Hs01_00093863 predicted 707
5 SASI_Hs01_00093864 predicted 580
6 SASI_Hs01_00093865 predicted 344
7 SASI_Hs01_00093866 predicted 580
8 SASI_Hs01_00093867 predicted 610
9 SASI_Hs01_00093868 predicted 498
10 SASI_Hs02_00332425 predicted 341
11 SASI_Hs01_00093861 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082356 predicted 1016
2 SASI_Hs01_00082357 predicted 1279
3 SASI_Hs01_00082359 predicted 1146
4 SASI_Hs01_00082360 predicted 1010
5 SASI_Hs01_00082361 predicted 885
6 SASI_Hs01_00082362 predicted 642
7 SASI_Hs01_00082363 predicted 890
8 SASI_Hs01_00082364 predicted 912
9 SASI_Hs02_00372639 predicted 808
10 SASI_Hs02_00372640 predicted 644
11 SASI_Hs01_00082358 predicted 1006
12 SASI_Hs01_00082365 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270194 predicted 673
2 SASI_Rn01_00072738 predicted 710
3 SASI_Rn01_00072739 predicted 649
4 SASI_Rn02_00270195 predicted 600
5 SASI_Rn01_00072741 predicted 308
6 SASI_Rn01_00072742 predicted 726
7 SASI_Rn01_00072744 predicted 808
8 SASI_Rn01_00072745 predicted 541
9 SASI_Rn01_00072747 predicted 378
10 SASI_Rn02_00270196 predicted 394
11 SASI_Rn01_00072740 predicted 708
12 SASI_Rn01_00072743 predicted 607
13 SASI_Rn01_00072746 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032085 predicted 597
2 SASI_Mm01_00032087 predicted 1003
3 SASI_Mm01_00032089 predicted 522
4 SASI_Mm01_00032091 predicted 597
5 SASI_Mm01_00032093 predicted 546
6 SASI_Mm02_00311930 predicted 276
7 SASI_Mm02_00311931 predicted 939
8 SASI_Mm01_00032084 predicted 263
9 SASI_Mm02_00311932 predicted 630
10 SASI_Mm02_00311933 predicted 674
11 SASI_Mm01_00032086 predicted 265
12 SASI_Mm01_00032088 predicted 282
13 SASI_Mm01_00032090 predicted 440
14 SASI_Mm01_00032092 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007563
BPGM MISSION shRNA Bacterial Glycerol Stock
2,3-bisphosphoglycerate mutase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007563.2-1495s1c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-855s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-498s1c1
Sequence:CCGGCCTCCTATAGAGGAGTCTCATCTCGAGATGAGACTCCTCTATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-270s1c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-384s1c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-269s21c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007563.4-1494s21c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-383s21c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-854s21c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007563
BPGM MISSION shRNA shRNA Plasmid DNA
2,3-bisphosphoglycerate mutase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007563.2-1495s1c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-855s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-498s1c1
Sequence:CCGGCCTCCTATAGAGGAGTCTCATCTCGAGATGAGACTCCTCTATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-270s1c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-384s1c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-269s21c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007563.4-1494s21c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-383s21c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-854s21c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007563
BPGM MISSION shRNA Lentiviral Transduction Particles
2,3-bisphosphoglycerate mutase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007563.2-1495s1c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-855s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-498s1c1
Sequence:CCGGCCTCCTATAGAGGAGTCTCATCTCGAGATGAGACTCCTCTATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-270s1c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007563.2-384s1c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-269s21c1
Sequence:CCGGCTCAACTTCGAGTTTGATCTTCTCGAGAAGATCAAACTCGAAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007563.4-1494s21c1
Sequence:CCGGGCAGTTTATATCCTTCTGTTTCTCGAGAAACAGAAGGATATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-383s21c1
Sequence:CCGGCGTCTGAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007563.4-854s21c1
Sequence:CCGGGCAGCCATTAAGAAAGTGGATCTCGAGATCCACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001724
VALIDATED
BPGM MISSION shRNA Bacterial Glycerol Stock
2,3-bisphosphoglycerate mutase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-719s1c1
Sequence:CCGGCCCGAAGTATTACGTGGCAAACTCGAGTTTGCCACGTAATACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-923s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTAGAACTCGAGTTCTACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001724.3-614s1c1
Sequence:CCGGCGGAGGTATAAAGTATGCGATCTCGAGATCGCATACTTTATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-845s1c1
Sequence:CCGGCCCATTCTTCTGGAATTGGATCTCGAGATCCAATTCCAGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-452s1c1
Sequence:CCGGCGTCTAAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-710s21c1
Sequence:CCGGAGGATTGCTCCCGAAGTATTACTCGAGTAATACTTCGGGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001724.3-1377s21c1
Sequence:CCGGGATAACAGTAAGGGATATTAGCTCGAGCTAATATCCCTTACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-322s21c1
Sequence:GTACCGGGAAGCAACTCAAAGCGTTAAACTCGAGTTTAACGCTTTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-913s21c1
Sequence:CCGGGGCGATCCAAGCAGCCATTAACTCGAGTTAATGGCTGCTTGGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-440s21c1
Sequence:CCGGGAAAGCTCCTGGCGTCTAAATCTCGAGATTTAGACGCCAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001724
VALIDATED
BPGM MISSION shRNA shRNA Plasmid DNA
2,3-bisphosphoglycerate mutase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-719s1c1
Sequence:CCGGCCCGAAGTATTACGTGGCAAACTCGAGTTTGCCACGTAATACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-923s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTAGAACTCGAGTTCTACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001724.3-614s1c1
Sequence:CCGGCGGAGGTATAAAGTATGCGATCTCGAGATCGCATACTTTATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-845s1c1
Sequence:CCGGCCCATTCTTCTGGAATTGGATCTCGAGATCCAATTCCAGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-452s1c1
Sequence:CCGGCGTCTAAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-710s21c1
Sequence:CCGGAGGATTGCTCCCGAAGTATTACTCGAGTAATACTTCGGGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001724.3-1377s21c1
Sequence:CCGGGATAACAGTAAGGGATATTAGCTCGAGCTAATATCCCTTACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-322s21c1
Sequence:GTACCGGGAAGCAACTCAAAGCGTTAAACTCGAGTTTAACGCTTTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-913s21c1
Sequence:CCGGGGCGATCCAAGCAGCCATTAACTCGAGTTAATGGCTGCTTGGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-440s21c1
Sequence:CCGGGAAAGCTCCTGGCGTCTAAATCTCGAGATTTAGACGCCAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001724
VALIDATED
BPGM MISSION shRNA Lentiviral Transduction Particles
2,3-bisphosphoglycerate mutase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-719s1c1
Sequence:CCGGCCCGAAGTATTACGTGGCAAACTCGAGTTTGCCACGTAATACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-923s1c1
Sequence:CCGGGCAGCCATTAAGAAAGTAGAACTCGAGTTCTACTTTCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001724.3-614s1c1
Sequence:CCGGCGGAGGTATAAAGTATGCGATCTCGAGATCGCATACTTTATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-845s1c1
Sequence:CCGGCCCATTCTTCTGGAATTGGATCTCGAGATCCAATTCCAGAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001724.3-452s1c1
Sequence:CCGGCGTCTAAATGAGCGTCACTATCTCGAGATAGTGACGCTCATTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-710s21c1
Sequence:CCGGAGGATTGCTCCCGAAGTATTACTCGAGTAATACTTCGGGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001724.3-1377s21c1
Sequence:CCGGGATAACAGTAAGGGATATTAGCTCGAGCTAATATCCCTTACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-322s21c1
Sequence:GTACCGGGAAGCAACTCAAAGCGTTAAACTCGAGTTTAACGCTTTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-913s21c1
Sequence:CCGGGGCGATCCAAGCAGCCATTAACTCGAGTTAATGGCTGCTTGGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001724.3-440s21c1
Sequence:CCGGGAAAGCTCCTGGCGTCTAAATCTCGAGATTTAGACGCCAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks