EMAIL THIS PAGE TO A FRIEND

BPHL

biphenyl hydrolase-like (serine hydrolase)

51 Gene Product Result for
Synonyms: BPH-RP MCNAA VACVASE
UniProtKB ID: Q86WA6, Q00306, Q13855, Q3KP51
Gene ID:
Human(670) Summary: This gene encodes a member of the serine protease family of hydrolytic enzymes which contain a serine in their active site. The encoded protein may play a role in activation of the antiviral prodrug valacyclovir. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Mouse(68021) biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen)
Rat(361239) biphenyl hydrolase-like (serine hydrolase)
sheep(101109920) biphenyl hydrolase-like (serine hydrolase)
naked mole-rat(101720065) biphenyl hydrolase-like (serine hydrolase)
domestic guinea pig(100728883) biphenyl hydrolase-like (serine hydrolase)
chicken(420885) biphenyl hydrolase-like (serine hydrolase)
domestic cat(101085122) biphenyl hydrolase-like (serine hydrolase)
cow(505457) biphenyl hydrolase-like (serine hydrolase)
dog(478700) biphenyl hydrolase-like (serine hydrolase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004332 Rosetta Predictions human pricing
NM_001037206 Rosetta Predictions rat pricing
NM_026512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247141 predicted 724
2 SASI_Hs02_00337382 predicted 592
3 SASI_Hs01_00247142 predicted 898
4 SASI_Hs01_00247143 predicted 903
5 SASI_Hs01_00247144 predicted 658
6 SASI_Hs01_00247145 predicted 779
7 SASI_Hs01_00247146 predicted 695
8 SASI_Hs01_00247147 predicted 662
9 SASI_Hs01_00247148 predicted 741
10 SASI_Hs01_00247149 predicted 437
11 SASI_Hs01_00247150 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121088 predicted 629
2 SASI_Rn01_00121089 predicted 200
3 SASI_Rn01_00121090 predicted 840
4 SASI_Rn01_00121091 predicted 529
5 SASI_Rn01_00121092 predicted 753
6 SASI_Rn01_00121094 predicted 899
7 SASI_Rn01_00121095 predicted 588
8 SASI_Rn02_00204320 predicted 764
9 SASI_Rn02_00204321 predicted 229
10 SASI_Rn01_00121096 predicted 447
11 SASI_Rn01_00121093 predicted 840
12 SASI_Rn01_00121097 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111771 predicted 848
2 SASI_Mm01_00111772 predicted 843
3 SASI_Mm01_00111773 predicted 642
4 SASI_Mm01_00111774 predicted 214
5 SASI_Mm01_00111775 predicted 548
6 SASI_Mm01_00111776 predicted 613
7 SASI_Mm01_00111777 predicted 763
8 SASI_Mm01_00111778 predicted 605
9 SASI_Mm01_00111779 predicted 462
10 SASI_Mm01_00111780 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026512
VALIDATED
BPHL MISSION shRNA Bacterial Glycerol Stock
biphenyl hydrolase-like (serine hydrolase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-232s21c1
Sequence:CCGGGGGTAGCGGAAAGACCGATTTCTCGAGAAATCGGTCTTTCCGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-555s21c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026512.1-946s21c1
Sequence:CCGGGATCATGTCATTGCCTGTTACCTCGAGGTAACAGGCAATGACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-259s21c1
Sequence:CCGGTCAGCTTCAGAGCCTAAATAACTCGAGTTATTTAGGCTCTGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-835s21c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-835s1c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026512.1-478s1c1
Sequence:CCGGCCCATCTTATATCCGCAAGATCTCGAGATCTTGCGGATATAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-555s1c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026512
VALIDATED
BPHL MISSION shRNA shRNA Plasmid DNA
biphenyl hydrolase-like (serine hydrolase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-232s21c1
Sequence:CCGGGGGTAGCGGAAAGACCGATTTCTCGAGAAATCGGTCTTTCCGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-555s21c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026512.1-946s21c1
Sequence:CCGGGATCATGTCATTGCCTGTTACCTCGAGGTAACAGGCAATGACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-259s21c1
Sequence:CCGGTCAGCTTCAGAGCCTAAATAACTCGAGTTATTTAGGCTCTGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-835s21c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-835s1c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026512.1-478s1c1
Sequence:CCGGCCCATCTTATATCCGCAAGATCTCGAGATCTTGCGGATATAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-555s1c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026512
VALIDATED
BPHL MISSION shRNA Lentiviral Transduction Particles
biphenyl hydrolase-like (serine hydrolase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-232s21c1
Sequence:CCGGGGGTAGCGGAAAGACCGATTTCTCGAGAAATCGGTCTTTCCGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-555s21c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026512.1-946s21c1
Sequence:CCGGGATCATGTCATTGCCTGTTACCTCGAGGTAACAGGCAATGACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-259s21c1
Sequence:CCGGTCAGCTTCAGAGCCTAAATAACTCGAGTTATTTAGGCTCTGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026512.1-835s21c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-835s1c1
Sequence:CCGGGCACAACTTACACTTACGCTTCTCGAGAAGCGTAAGTGTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026512.1-478s1c1
Sequence:CCGGCCCATCTTATATCCGCAAGATCTCGAGATCTTGCGGATATAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026512.1-555s1c1
Sequence:CCGGGTATCCGAGATGTTTCTAAATCTCGAGATTTAGAAACATCTCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004332
VALIDATED
BPHL MISSION shRNA Bacterial Glycerol Stock
biphenyl hydrolase-like (serine hydrolase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-884s21c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004332.2-480s21c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-582s21c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-170s21c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-295s21c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004332.1-694s1c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-592s1c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-282s1c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-407s1c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-996s1c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004332
VALIDATED
BPHL MISSION shRNA shRNA Plasmid DNA
biphenyl hydrolase-like (serine hydrolase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-884s21c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004332.2-480s21c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-582s21c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-170s21c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-295s21c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004332.1-694s1c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-592s1c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-282s1c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-407s1c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-996s1c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004332
VALIDATED
BPHL MISSION shRNA Lentiviral Transduction Particles
biphenyl hydrolase-like (serine hydrolase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-884s21c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004332.2-480s21c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-582s21c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-170s21c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004332.2-295s21c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004332.1-694s1c1
Sequence:CCGGGCATCCGAGATGTTTCCAAATCTCGAGATTTGGAAACATCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-592s1c1
Sequence:CCGGCCGCACTCATTGCTGCTGCAACTCGAGTTGCAGCAGCAATGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-282s1c1
Sequence:CCGGTCTGCCAAAGTGGCTGTGAATCTCGAGATTCACAGCCACTTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-407s1c1
Sequence:CCGGGAACCTCAATAAGAAGCTCTTCTCGAGAAGAGCTTCTTATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004332.1-996s1c1
Sequence:CCGGGCAGATGAATTCAACAAGTTACTCGAGTAACTTGTTGAATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks