EMAIL THIS PAGE TO A FRIEND

BPI

bactericidal/permeability-increasing protein

49 Gene Product Result for
Synonyms: BPIFD1 rBPI
Gene ID:
Human(671) Summary: This gene encodes a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. [provided by RefSeq, Jul 2008]
Mouse(329547) bactericidal permeablility increasing protein
Rat(296321) bactericidal/permeability-increasing protein
chicken(419293) bactericidal/permeability-increasing protein
cow(280734) bactericidal/permeability-increasing protein
Horse(100070091) bactericidal/permeability-increasing protein
domestic cat(101094663) bactericidal/permeability-increasing protein
dog(477226) bactericidal/permeability-increasing protein
domestic guinea pig(100713739) bactericidal/permeability-increasing protein
naked mole-rat(101698087) bactericidal/permeability-increasing protein
sheep(101104332) bactericidal/permeability-increasing protein
Domestic Rabbit(100009228) bactericidal/permeability-increasing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001725 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024831 MISSION® esiRNA esiRNA human BPI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001725 Rosetta Predictions human pricing
NM_001004079 Rosetta Predictions rat pricing
NM_177850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036106 predicted 369
2 SASI_Hs01_00036108 predicted 246
3 SASI_Hs01_00036109 predicted 610
4 SASI_Hs01_00036110 predicted 1085
5 SASI_Hs01_00036111 predicted 353
6 SASI_Hs01_00036112 predicted 273
7 SASI_Hs01_00036113 predicted 1366
8 SASI_Hs01_00036114 predicted 488
9 SASI_Hs02_00332426 predicted 1602
10 SASI_Hs01_00036115 predicted 470
11 SASI_Hs01_00036107 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085437 predicted 1465
2 SASI_Rn01_00085438 predicted 671
3 SASI_Rn01_00085439 predicted 596
4 SASI_Rn01_00085440 predicted 1133
5 SASI_Rn02_00198106 predicted 1232
6 SASI_Rn01_00085441 predicted 564
7 SASI_Rn01_00085442 predicted 544
8 SASI_Rn01_00085443 predicted 1507
9 SASI_Rn01_00085444 predicted 808
10 SASI_Rn01_00085445 predicted 395
11 SASI_Rn01_00085446 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184373 predicted 987
2 SASI_Mm01_00184374 predicted 1494
3 SASI_Mm01_00184375 predicted 218
4 SASI_Mm01_00184376 predicted 1478
5 SASI_Mm01_00184377 predicted 1370
6 SASI_Mm01_00184378 predicted 1348
7 SASI_Mm01_00184380 predicted 837
8 SASI_Mm01_00184381 predicted 395
9 SASI_Mm01_00184382 predicted 303
10 SASI_Mm02_00348323 predicted 759
11 SASI_Mm01_00184379 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177850
BPI MISSION shRNA Bacterial Glycerol Stock
bactericidal/permeability-increasing protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177850.2-1587s1c1
Sequence:CCGGCCAGGAATCCTATTTAGTCTTCTCGAGAAGACTAAATAGGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-306s1c1
Sequence:CCGGGCTGTGGATGGATTTCATATTCTCGAGAATATGAAATCCATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1353s1c1
Sequence:CCGGGATGTCATAAACTACCTCGTACTCGAGTACGAGGTAGTTTATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1484s1c1
Sequence:CCGGCCTGTTGCTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-881s1c1
Sequence:CCGGCGGTGCATACATGGTATGCATCTCGAGATGCATACCATGTATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177850
BPI MISSION shRNA shRNA Plasmid DNA
bactericidal/permeability-increasing protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177850.2-1587s1c1
Sequence:CCGGCCAGGAATCCTATTTAGTCTTCTCGAGAAGACTAAATAGGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-306s1c1
Sequence:CCGGGCTGTGGATGGATTTCATATTCTCGAGAATATGAAATCCATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1353s1c1
Sequence:CCGGGATGTCATAAACTACCTCGTACTCGAGTACGAGGTAGTTTATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1484s1c1
Sequence:CCGGCCTGTTGCTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-881s1c1
Sequence:CCGGCGGTGCATACATGGTATGCATCTCGAGATGCATACCATGTATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177850
BPI MISSION shRNA Lentiviral Transduction Particles
bactericidal/permeability-increasing protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177850.2-1587s1c1
Sequence:CCGGCCAGGAATCCTATTTAGTCTTCTCGAGAAGACTAAATAGGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-306s1c1
Sequence:CCGGGCTGTGGATGGATTTCATATTCTCGAGAATATGAAATCCATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1353s1c1
Sequence:CCGGGATGTCATAAACTACCTCGTACTCGAGTACGAGGTAGTTTATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-1484s1c1
Sequence:CCGGCCTGTTGCTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177850.2-881s1c1
Sequence:CCGGCGGTGCATACATGGTATGCATCTCGAGATGCATACCATGTATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001725
BPI MISSION shRNA Bacterial Glycerol Stock
bactericidal/permeability-increasing protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-643s1c1
Sequence:CCGGGTCTGCGAGAAAGTGACCAATCTCGAGATTGGTCACTTTCTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-954s1c1
Sequence:CCGGGATGACCCTTAGAGATGACATCTCGAGATGTCATCTCTAAGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-1323s1c1
Sequence:CCGGGCTGCAGGATATCATGAACTACTCGAGTAGTTCATGATATCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1616s1c1
Sequence:CCGGCGACTCAGATTCAGAAATGATCTCGAGATCATTTCTGAATCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-238s1c1
Sequence:CCGGGACAGCTTTAAGATCAAGCATCTCGAGATGCTTGATCTTAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1606s1c1
Sequence:CCGGCAAACTTCTTCGACTCAGATTCTCGAGAATCTGAGTCGAAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-957s1c1
Sequence:CCGGGACCCTTAGAGATGACATGATCTCGAGATCATGTCATCTCTAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-391s21c1
Sequence:CCGGCCATCAGCAACGCCAATATCACTCGAGTGATATTGGCGTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-485s21c1
Sequence:CCGGCATGTCCATTTCGGCTGATCTCTCGAGAGATCAGCCGAAATGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-341s21c1
Sequence:CCGGGCTTCCCAGTTCCCAGATAAGCTCGAGCTTATCTGGGAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001725
BPI MISSION shRNA shRNA Plasmid DNA
bactericidal/permeability-increasing protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-643s1c1
Sequence:CCGGGTCTGCGAGAAAGTGACCAATCTCGAGATTGGTCACTTTCTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-954s1c1
Sequence:CCGGGATGACCCTTAGAGATGACATCTCGAGATGTCATCTCTAAGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-1323s1c1
Sequence:CCGGGCTGCAGGATATCATGAACTACTCGAGTAGTTCATGATATCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1616s1c1
Sequence:CCGGCGACTCAGATTCAGAAATGATCTCGAGATCATTTCTGAATCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-238s1c1
Sequence:CCGGGACAGCTTTAAGATCAAGCATCTCGAGATGCTTGATCTTAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1606s1c1
Sequence:CCGGCAAACTTCTTCGACTCAGATTCTCGAGAATCTGAGTCGAAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-957s1c1
Sequence:CCGGGACCCTTAGAGATGACATGATCTCGAGATCATGTCATCTCTAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-391s21c1
Sequence:CCGGCCATCAGCAACGCCAATATCACTCGAGTGATATTGGCGTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-485s21c1
Sequence:CCGGCATGTCCATTTCGGCTGATCTCTCGAGAGATCAGCCGAAATGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-341s21c1
Sequence:CCGGGCTTCCCAGTTCCCAGATAAGCTCGAGCTTATCTGGGAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001725
BPI MISSION shRNA Lentiviral Transduction Particles
bactericidal/permeability-increasing protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-643s1c1
Sequence:CCGGGTCTGCGAGAAAGTGACCAATCTCGAGATTGGTCACTTTCTCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-954s1c1
Sequence:CCGGGATGACCCTTAGAGATGACATCTCGAGATGTCATCTCTAAGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-1323s1c1
Sequence:CCGGGCTGCAGGATATCATGAACTACTCGAGTAGTTCATGATATCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1616s1c1
Sequence:CCGGCGACTCAGATTCAGAAATGATCTCGAGATCATTTCTGAATCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-238s1c1
Sequence:CCGGGACAGCTTTAAGATCAAGCATCTCGAGATGCTTGATCTTAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001725.1-1606s1c1
Sequence:CCGGCAAACTTCTTCGACTCAGATTCTCGAGAATCTGAGTCGAAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001725.1-957s1c1
Sequence:CCGGGACCCTTAGAGATGACATGATCTCGAGATCATGTCATCTCTAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-391s21c1
Sequence:CCGGCCATCAGCAACGCCAATATCACTCGAGTGATATTGGCGTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-485s21c1
Sequence:CCGGCATGTCCATTTCGGCTGATCTCTCGAGAGATCAGCCGAAATGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001725.2-341s21c1
Sequence:CCGGGCTTCCCAGTTCCCAGATAAGCTCGAGCTTATCTGGGAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks