EMAIL THIS PAGE TO A FRIEND

BPIFA1

BPI fold containing family A, member 1

83 Gene Product Result for
Synonyms: LUNX NASG PLUNC SPLUNC1 SPURT bA49G10.5
UniProtKB ID: Q9NP55, A8K9R3, E1P5M9, Q9NZT0
Gene ID:
Human(51297) Summary: This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The exact biological function of this gene is not known, however, it has been suggested to be involved in inflammatory responses to irritants in the upper airways. It may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2011]
Mouse(18843) BPI fold containing family A, member 1
Rat(246238) BPI fold containing family A, member 1
sheep(101108150) BPI fold containing family A, member 1
naked mole-rat(101722875) BPI fold containing family A, member 1
domestic guinea pig(100715971) BPI fold containing family A, member 1
dog(609982) BPI fold containing family A, member 1
domestic cat(101091273) BPI fold containing family A, member 1
cow(281989) BPI fold containing family A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42475 Anti-PLUNC antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, pig, rat, canine, bovine, rabbit
western blot pricing
SAB1401687 Monoclonal Anti-PLUNC antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132221 MISSION® esiRNA esiRNA human PLUNC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016583 Rosetta Predictions human pricing
NM_130852 Rosetta Predictions human pricing
NM_172031 Rosetta Predictions rat pricing
XM_579690 Rosetta Predictions rat pricing
NM_011126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087998 predicted 197
2 SASI_Hs01_00087999 predicted 365
3 SASI_Hs01_00088001 predicted 458
4 SASI_Hs01_00088002 predicted 540
5 SASI_Hs01_00088003 predicted 595
6 SASI_Hs01_00088006 predicted 561
7 SASI_Hs01_00088007 predicted 203
8 SASI_Hs02_00349712 predicted 627
9 SASI_Hs02_00349713 predicted 630
10 SASI_Hs01_00088004 predicted 529
11 SASI_Hs01_00088000 predicted 557
12 SASI_Hs01_00088005 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134130 predicted 204
2 SASI_Hs01_00134131 predicted 367
3 SASI_Hs01_00134133 predicted 461
4 SASI_Hs01_00134134 predicted 533
5 SASI_Hs01_00134135 predicted 594
6 SASI_Hs01_00134138 predicted 559
7 SASI_Hs01_00134139 predicted 207
8 SASI_Hs02_00362898 predicted 624
9 SASI_Hs02_00362899 predicted 626
10 SASI_Hs01_00134136 predicted 524
11 SASI_Hs01_00134132 predicted 548
12 SASI_Hs01_00134137 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087506 predicted 831
2 SASI_Rn01_00087507 predicted 656
3 SASI_Rn01_00087508 predicted 818
4 SASI_Rn01_00087509 predicted 306
5 SASI_Rn01_00087511 predicted 499
6 SASI_Rn01_00087513 predicted 578
7 SASI_Rn01_00087514 predicted 502
8 SASI_Rn01_00087515 predicted 738
9 SASI_Rn02_00269119 predicted 838
10 SASI_Rn02_00269120 predicted 686
11 SASI_Rn01_00087510 predicted 408
12 SASI_Rn01_00087512 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166424 predicted 304
2 SASI_Rn01_00166425 predicted 311
3 SASI_Rn01_00166426 predicted 203
4 SASI_Rn01_00166427 predicted 308
5 SASI_Rn01_00166428 predicted 227
6 SASI_Rn01_00166429 predicted 226
7 SASI_Rn01_00166430 predicted 206
8 SASI_Rn01_00166431 predicted 308
9 SASI_Rn01_00166432 predicted 204
10 SASI_Rn01_00166433 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150190 predicted 489
2 SASI_Mm01_00150191 predicted 864
3 SASI_Mm01_00150192 predicted 458
4 SASI_Mm01_00150193 predicted 341
5 SASI_Mm01_00150194 predicted 453
6 SASI_Mm01_00150195 predicted 606
7 SASI_Mm01_00150196 predicted 215
8 SASI_Mm01_00150197 predicted 606
9 SASI_Mm01_00150198 predicted 757
10 SASI_Mm01_00150199 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016583
BPIFA1 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-476s1c1
Sequence:CCGGCGGCATAAAGCTCCAAGTGAACTCGAGTTCACTTGGAGCTTTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-569s1c1
Sequence:CCGGGAGAGATAAGCAGGAGAGGATCTCGAGATCCTCTCCTGCTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-369s1c1
Sequence:CCGGCCTGGCCTGAACAACATCATTCTCGAGAATGATGTTGTTCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-373s1c1
Sequence:CCGGGCCTGAACAACATCATTGACACTCGAGTGTCAATGATGTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-552s1c1
Sequence:CCGGGCAGAAATCTTAGCTGTGAGACTCGAGTCTCACAGCTAAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-704s1c1
Sequence:CCGGGAATAAAGTCCTGCCTGAGTTCTCGAGAACTCAGGCAGGACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-782s1c1
Sequence:CCGGCCTGGTGCATGACATTGTTAACTCGAGTTAACAATGTCATGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-555s1c1
Sequence:CCGGGAAATCTTAGCTGTGAGAGATCTCGAGATCTCTCACAGCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-374s1c1
Sequence:CCGGCCTGAACAACATCATTGACATCTCGAGATGTCAATGATGTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016583
BPIFA1 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-476s1c1
Sequence:CCGGCGGCATAAAGCTCCAAGTGAACTCGAGTTCACTTGGAGCTTTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-569s1c1
Sequence:CCGGGAGAGATAAGCAGGAGAGGATCTCGAGATCCTCTCCTGCTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-369s1c1
Sequence:CCGGCCTGGCCTGAACAACATCATTCTCGAGAATGATGTTGTTCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-373s1c1
Sequence:CCGGGCCTGAACAACATCATTGACACTCGAGTGTCAATGATGTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-552s1c1
Sequence:CCGGGCAGAAATCTTAGCTGTGAGACTCGAGTCTCACAGCTAAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-704s1c1
Sequence:CCGGGAATAAAGTCCTGCCTGAGTTCTCGAGAACTCAGGCAGGACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-782s1c1
Sequence:CCGGCCTGGTGCATGACATTGTTAACTCGAGTTAACAATGTCATGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-555s1c1
Sequence:CCGGGAAATCTTAGCTGTGAGAGATCTCGAGATCTCTCACAGCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-374s1c1
Sequence:CCGGCCTGAACAACATCATTGACATCTCGAGATGTCAATGATGTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016583
BPIFA1 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-476s1c1
Sequence:CCGGCGGCATAAAGCTCCAAGTGAACTCGAGTTCACTTGGAGCTTTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-569s1c1
Sequence:CCGGGAGAGATAAGCAGGAGAGGATCTCGAGATCCTCTCCTGCTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-369s1c1
Sequence:CCGGCCTGGCCTGAACAACATCATTCTCGAGAATGATGTTGTTCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-373s1c1
Sequence:CCGGGCCTGAACAACATCATTGACACTCGAGTGTCAATGATGTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-552s1c1
Sequence:CCGGGCAGAAATCTTAGCTGTGAGACTCGAGTCTCACAGCTAAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-704s1c1
Sequence:CCGGGAATAAAGTCCTGCCTGAGTTCTCGAGAACTCAGGCAGGACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-782s1c1
Sequence:CCGGCCTGGTGCATGACATTGTTAACTCGAGTTAACAATGTCATGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016583.2-555s1c1
Sequence:CCGGGAAATCTTAGCTGTGAGAGATCTCGAGATCTCTCACAGCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016583.2-374s1c1
Sequence:CCGGCCTGAACAACATCATTGACATCTCGAGATGTCAATGATGTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011126
BPIFA1 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011126.1-924s1c1
Sequence:CCGGGCTGAATCATTTCTTGCTGCTCTCGAGAGCAGCAAGAAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-537s1c1
Sequence:CCGGGCTTGACACTCAACGTAAATACTCGAGTATTTACGTTGAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-733s1c1
Sequence:CCGGAGACAACCTCACAGGGATATTCTCGAGAATATCCCTGTGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-534s1c1
Sequence:CCGGTGGGCTTGACACTCAACGTAACTCGAGTTACGTTGAGTGTCAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-608s1c1
Sequence:CCGGGCAGAAGTCTTAGCCGTGAAACTCGAGTTTCACGGCTAAGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011126
BPIFA1 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011126.1-924s1c1
Sequence:CCGGGCTGAATCATTTCTTGCTGCTCTCGAGAGCAGCAAGAAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-537s1c1
Sequence:CCGGGCTTGACACTCAACGTAAATACTCGAGTATTTACGTTGAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-733s1c1
Sequence:CCGGAGACAACCTCACAGGGATATTCTCGAGAATATCCCTGTGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-534s1c1
Sequence:CCGGTGGGCTTGACACTCAACGTAACTCGAGTTACGTTGAGTGTCAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-608s1c1
Sequence:CCGGGCAGAAGTCTTAGCCGTGAAACTCGAGTTTCACGGCTAAGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011126
BPIFA1 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011126.1-924s1c1
Sequence:CCGGGCTGAATCATTTCTTGCTGCTCTCGAGAGCAGCAAGAAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-537s1c1
Sequence:CCGGGCTTGACACTCAACGTAAATACTCGAGTATTTACGTTGAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-733s1c1
Sequence:CCGGAGACAACCTCACAGGGATATTCTCGAGAATATCCCTGTGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-534s1c1
Sequence:CCGGTGGGCTTGACACTCAACGTAACTCGAGTTACGTTGAGTGTCAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011126.1-608s1c1
Sequence:CCGGGCAGAAGTCTTAGCCGTGAAACTCGAGTTTCACGGCTAAGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks