EMAIL THIS PAGE TO A FRIEND

BPIFA3

BPI fold containing family A, member 3

76 Gene Product Result for
Synonyms: C20orf71 SPLUNC3
UniProtKB ID: Q9BQP9, Q5JWG8, Q6NZ38
Gene ID:
Mouse(73388) BPI fold containing family A, member 3
Rat(690402) BPI fold containing family A, member 3
domestic guinea pig(100728133) BPI fold containing family A, member 3
naked mole-rat(101705020) BPI fold containing family A, member 3
sheep(101107884) BPI fold containing family A, member 3
domestic cat(101091526) BPI fold containing family A, member 3
dog(609978) BPI fold containing family A, member 3
cow(516692) BPI fold containing family A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040671 MISSION® esiRNA esiRNA human C20orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014978 Rosetta Predictions human pricing
NM_001042439 Rosetta Predictions human pricing
NM_178466 Rosetta Predictions human pricing
NM_001109588 Rosetta Predictions rat pricing
NM_028528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015767 predicted 535
2 SASI_Hs01_00015768 predicted 525
3 SASI_Hs01_00015769 predicted 491
4 SASI_Hs01_00015770 predicted 576
5 SASI_Hs01_00015771 predicted 288
6 SASI_Hs01_00015772 predicted 354
7 SASI_Hs01_00015773 predicted 338
8 SASI_Hs01_00015774 predicted 545
9 SASI_Hs01_00015775 predicted 427
10 SASI_Hs01_00015776 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309768 predicted 213
2 SASI_Hs02_00309769 predicted 742
3 SASI_Hs02_00309770 predicted 720
4 SASI_Hs02_00309771 predicted 713
5 SASI_Hs02_00309772 predicted 222
6 SASI_Hs02_00309773 predicted 741
7 SASI_Hs02_00309774 predicted 700
8 SASI_Hs02_00309775 predicted 695
9 SASI_Hs02_00309776 predicted 708
10 SASI_Hs02_00309777 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369710 predicted 211
2 SASI_Hs02_00369711 predicted 852
3 SASI_Hs02_00369712 predicted 828
4 SASI_Hs02_00369713 predicted 825
5 SASI_Hs02_00369714 predicted 220
6 SASI_Hs02_00369715 predicted 854
7 SASI_Hs02_00369716 predicted 805
8 SASI_Hs02_00369717 predicted 800
9 SASI_Hs02_00369718 predicted 816
10 SASI_Hs02_00369719 predicted 801
11 SASI_Hs01_00179230 predicted 539
12 SASI_Hs01_00179231 predicted 527
13 SASI_Hs01_00179232 predicted 494
14 SASI_Hs01_00179233 predicted 573
15 SASI_Hs01_00179234 predicted 288
16 SASI_Hs01_00179235 predicted 354
17 SASI_Hs01_00179236 predicted 340
18 SASI_Hs01_00179237 predicted 548
19 SASI_Hs01_00179238 predicted 418
20 SASI_Hs01_00179239 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249861 predicted 833
2 SASI_Rn02_00249862 predicted 786
3 SASI_Rn02_00249863 predicted 354
4 SASI_Rn02_00249864 predicted 697
5 SASI_Rn02_00249865 predicted 703
6 SASI_Rn02_00249866 predicted 422
7 SASI_Rn02_00249867 predicted 791
8 SASI_Rn02_00249868 predicted 670
9 SASI_Rn02_00249869 predicted 518
10 SASI_Rn02_00249870 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128298 predicted 718
2 SASI_Mm01_00128299 predicted 541
3 SASI_Mm01_00128300 predicted 568
4 SASI_Mm01_00128301 predicted 416
5 SASI_Mm01_00128302 predicted 346
6 SASI_Mm01_00128303 predicted 759
7 SASI_Mm01_00128304 predicted 519
8 SASI_Mm01_00128305 predicted 790
9 SASI_Mm01_00128306 predicted 458
10 SASI_Mm02_00334005 predicted 769
11 SASI_Mm01_00128307 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178466
BPIFA3 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-832s21c1
Sequence:CCGGATGTCCTCTGATCGGTGAAATCTCGAGATTTCACCGATCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-352s21c1
Sequence:CCGGCATAAAGCACAACGCAGAAAGCTCGAGCTTTCTGCGTTGTGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-486s21c1
Sequence:CCGGGCATCAACATCACCAACATTCCTCGAGGAATGTTGGTGATGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-275s1c1
Sequence:CCGGCCCACAGAGACAACAAATCCACTCGAGTGGATTTGTTGTCTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-745s1c1
Sequence:CCGGCTCTACAACCTCAAAGAGAATCTCGAGATTCTCTTTGAGGTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-585s1c1
Sequence:CCGGCGTAAAGATGTGTGCACATATCTCGAGATATGTGCACACATCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-552s1c1
Sequence:CCGGCCTTGAATTGAGACCGTCCTTCTCGAGAAGGACGGTCTCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-724s1c1
Sequence:CCGGCCACCAAAGATGAATCAGTTTCTCGAGAAACTGATTCATCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-459s1c1
Sequence:CCGGCATCAACATCACCAACATTCACTCGAGTGAATGTTGGTGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-527s1c1
Sequence:CCGGCGGCAAATATCTCACTTGAATCTCGAGATTCAAGTGAGATATTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-569s1c1
Sequence:CCGGCCTTCGATAACAACATCGTAACTCGAGTTACGATGTTGTTATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178466
BPIFA3 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-832s21c1
Sequence:CCGGATGTCCTCTGATCGGTGAAATCTCGAGATTTCACCGATCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-352s21c1
Sequence:CCGGCATAAAGCACAACGCAGAAAGCTCGAGCTTTCTGCGTTGTGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-486s21c1
Sequence:CCGGGCATCAACATCACCAACATTCCTCGAGGAATGTTGGTGATGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-275s1c1
Sequence:CCGGCCCACAGAGACAACAAATCCACTCGAGTGGATTTGTTGTCTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-745s1c1
Sequence:CCGGCTCTACAACCTCAAAGAGAATCTCGAGATTCTCTTTGAGGTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-585s1c1
Sequence:CCGGCGTAAAGATGTGTGCACATATCTCGAGATATGTGCACACATCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-552s1c1
Sequence:CCGGCCTTGAATTGAGACCGTCCTTCTCGAGAAGGACGGTCTCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-724s1c1
Sequence:CCGGCCACCAAAGATGAATCAGTTTCTCGAGAAACTGATTCATCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-459s1c1
Sequence:CCGGCATCAACATCACCAACATTCACTCGAGTGAATGTTGGTGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-527s1c1
Sequence:CCGGCGGCAAATATCTCACTTGAATCTCGAGATTCAAGTGAGATATTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-569s1c1
Sequence:CCGGCCTTCGATAACAACATCGTAACTCGAGTTACGATGTTGTTATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178466
BPIFA3 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-832s21c1
Sequence:CCGGATGTCCTCTGATCGGTGAAATCTCGAGATTTCACCGATCAGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-352s21c1
Sequence:CCGGCATAAAGCACAACGCAGAAAGCTCGAGCTTTCTGCGTTGTGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178466.3-486s21c1
Sequence:CCGGGCATCAACATCACCAACATTCCTCGAGGAATGTTGGTGATGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-275s1c1
Sequence:CCGGCCCACAGAGACAACAAATCCACTCGAGTGGATTTGTTGTCTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-745s1c1
Sequence:CCGGCTCTACAACCTCAAAGAGAATCTCGAGATTCTCTTTGAGGTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-585s1c1
Sequence:CCGGCGTAAAGATGTGTGCACATATCTCGAGATATGTGCACACATCTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-552s1c1
Sequence:CCGGCCTTGAATTGAGACCGTCCTTCTCGAGAAGGACGGTCTCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-724s1c1
Sequence:CCGGCCACCAAAGATGAATCAGTTTCTCGAGAAACTGATTCATCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178466.1-459s1c1
Sequence:CCGGCATCAACATCACCAACATTCACTCGAGTGAATGTTGGTGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-527s1c1
Sequence:CCGGCGGCAAATATCTCACTTGAATCTCGAGATTCAAGTGAGATATTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178466.1-569s1c1
Sequence:CCGGCCTTCGATAACAACATCGTAACTCGAGTTACGATGTTGTTATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028528
BPIFA3 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028528.1-1060s1c1
Sequence:CCGGCCTGTCCTTTCCAACAATAAACTCGAGTTTATTGTTGGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-773s1c1
Sequence:CCGGGCCTAGGGAAAGTTATCCCAACTCGAGTTGGGATAACTTTCCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-306s1c1
Sequence:CCGGCCTAGCGAGAATTATTGCACACTCGAGTGTGCAATAATTCTCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-883s1c1
Sequence:CCGGCCTGCTCATAATCTGGGTCAACTCGAGTTGACCCAGATTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-576s1c1
Sequence:CCGGGCCCTTCAATTCGAATATCATCTCGAGATGATATTCGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028528
BPIFA3 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028528.1-1060s1c1
Sequence:CCGGCCTGTCCTTTCCAACAATAAACTCGAGTTTATTGTTGGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-773s1c1
Sequence:CCGGGCCTAGGGAAAGTTATCCCAACTCGAGTTGGGATAACTTTCCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-306s1c1
Sequence:CCGGCCTAGCGAGAATTATTGCACACTCGAGTGTGCAATAATTCTCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-883s1c1
Sequence:CCGGCCTGCTCATAATCTGGGTCAACTCGAGTTGACCCAGATTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-576s1c1
Sequence:CCGGGCCCTTCAATTCGAATATCATCTCGAGATGATATTCGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028528
BPIFA3 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028528.1-1060s1c1
Sequence:CCGGCCTGTCCTTTCCAACAATAAACTCGAGTTTATTGTTGGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-773s1c1
Sequence:CCGGGCCTAGGGAAAGTTATCCCAACTCGAGTTGGGATAACTTTCCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-306s1c1
Sequence:CCGGCCTAGCGAGAATTATTGCACACTCGAGTGTGCAATAATTCTCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-883s1c1
Sequence:CCGGCCTGCTCATAATCTGGGTCAACTCGAGTTGACCCAGATTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028528.1-576s1c1
Sequence:CCGGGCCCTTCAATTCGAATATCATCTCGAGATGATATTCGAATTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks