EMAIL THIS PAGE TO A FRIEND

BPIFA4P

BPI fold containing family A, member 4, pseudogene

42 Gene Product Result for
Synonyms: BASE
Species: Human BPIFA4P(317716)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173859 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173859 Rosetta Predictions human pricing
XR_042114 Rosetta Predictions human pricing
XR_042115 Rosetta Predictions human pricing
XR_042116 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091911 predicted 477
2 SASI_Hs01_00091912 predicted 427
3 SASI_Hs01_00091913 predicted 290
4 SASI_Hs01_00091914 predicted 374
5 SASI_Hs01_00091915 predicted 644
6 SASI_Hs01_00091916 predicted 754
7 SASI_Hs01_00091917 predicted 284
8 SASI_Hs01_00091918 predicted 838
9 SASI_Hs01_00091919 predicted 490
10 SASI_Hs01_00091920 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533179 predicted 420
2 SASI_Hs02_00533180 predicted 240
3 SASI_Hs02_00533181 predicted 320
4 SASI_Hs02_00533182 predicted 313
5 SASI_Hs02_00533183 predicted 306
6 SASI_Hs02_00533184 predicted 227
7 SASI_Hs02_00533185 predicted 379
8 SASI_Hs02_00533186 predicted 219
9 SASI_Hs02_00533187 predicted 432
10 SASI_Hs02_00533188 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533189 predicted 417
2 SASI_Hs02_00533190 predicted 234
3 SASI_Hs02_00533191 predicted 324
4 SASI_Hs02_00533192 predicted 307
5 SASI_Hs02_00533193 predicted 311
6 SASI_Hs02_00533194 predicted 225
7 SASI_Hs02_00533195 predicted 376
8 SASI_Hs02_00533196 predicted 216
9 SASI_Hs02_00533197 predicted 432
10 SASI_Hs02_00533198 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533199 predicted 414
2 SASI_Hs02_00533200 predicted 236
3 SASI_Hs02_00533201 predicted 324
4 SASI_Hs02_00533202 predicted 306
5 SASI_Hs02_00533203 predicted 309
6 SASI_Hs02_00533204 predicted 231
7 SASI_Hs02_00533205 predicted 378
8 SASI_Hs02_00533206 predicted 214
9 SASI_Hs02_00533207 predicted 426
10 SASI_Hs02_00533208 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173859
BPIFA4P MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 4, pseudogene
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000084108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173859.1-971s1c1
Sequence:CCGGCCCTGTAATCTTCCCACAATACTCGAGTATTGTGGGAAGATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-524s1c1
Sequence:CCGGCCGAGGCTATTTGGATCCAAACTCGAGTTTGGATCCAAATAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-277s1c1
Sequence:CCGGACCAATGAGATCAACACTGTTCTCGAGAACAGTGTTGATCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-430s1c1
Sequence:CCGGGCTAATATGCAGTCAGATATACTCGAGTATATCTGACTGCATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173859
BPIFA4P MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 4, pseudogene
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000084108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173859.1-971s1c1
Sequence:CCGGCCCTGTAATCTTCCCACAATACTCGAGTATTGTGGGAAGATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-524s1c1
Sequence:CCGGCCGAGGCTATTTGGATCCAAACTCGAGTTTGGATCCAAATAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-277s1c1
Sequence:CCGGACCAATGAGATCAACACTGTTCTCGAGAACAGTGTTGATCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-430s1c1
Sequence:CCGGGCTAATATGCAGTCAGATATACTCGAGTATATCTGACTGCATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173859
BPIFA4P MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 4, pseudogene
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000084108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173859.1-971s1c1
Sequence:CCGGCCCTGTAATCTTCCCACAATACTCGAGTATTGTGGGAAGATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-524s1c1
Sequence:CCGGCCGAGGCTATTTGGATCCAAACTCGAGTTTGGATCCAAATAGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-277s1c1
Sequence:CCGGACCAATGAGATCAACACTGTTCTCGAGAACAGTGTTGATCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173859.1-430s1c1
Sequence:CCGGGCTAATATGCAGTCAGATATACTCGAGTATATCTGACTGCATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks