EMAIL THIS PAGE TO A FRIEND

BPIFB1

BPI fold containing family B, member 1

67 Gene Product Result for
Synonyms: C20orf114 LPLUNC1
Gene ID:
Human(92747) Summary: The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
Mouse(228801) BPI fold containing family B, member 1
Rat(499926) BPI fold containing family B, member 1
naked mole-rat(101722184) BPI fold containing family B, member 1
domestic guinea pig(100728694) BPI fold containing family B, member 1
sheep(101108410) BPI fold containing family B, member 1
dog(477194) BPI fold containing family B, member 1
cow(282643) BPI fold containing family B, member 1
domestic cat(101099454) BPI fold containing family B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033197 Rosetta Predictions human pricing
NM_001077680 Rosetta Predictions rat pricing
NM_001012392 Rosetta Predictions mouse pricing
NM_153418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078950 predicted 829
2 SASI_Hs01_00078951 predicted 1150
3 SASI_Hs02_00360988 predicted 818
4 SASI_Hs01_00078952 predicted 874
5 SASI_Hs01_00078954 predicted 1322
6 SASI_Hs01_00078955 predicted 925
7 SASI_Hs01_00078956 predicted 1111
8 SASI_Hs01_00078957 predicted 1463
9 SASI_Hs01_00078958 predicted 1168
10 SASI_Hs01_00078959 predicted 1440
11 SASI_Hs01_00078953 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207919 predicted 660
2 SASI_Rn02_00207920 predicted 1223
3 SASI_Rn02_00207921 predicted 1117
4 SASI_Rn02_00207922 predicted 1183
5 SASI_Rn02_00207923 predicted 760
6 SASI_Rn02_00207924 predicted 1317
7 SASI_Rn02_00207925 predicted 1243
8 SASI_Rn02_00207926 predicted 513
9 SASI_Rn02_00207927 predicted 958
10 SASI_Rn02_00207928 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120986 predicted 726
2 SASI_Mm01_00120987 predicted 1343
3 SASI_Mm01_00120988 predicted 344
4 SASI_Mm01_00120989 predicted 817
5 SASI_Mm01_00120990 predicted 653
6 SASI_Mm01_00120991 predicted 1032
7 SASI_Mm01_00120992 predicted 299
8 SASI_Mm01_00120993 predicted 1278
9 SASI_Mm01_00120994 predicted 747
10 SASI_Mm01_00120995 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139583 predicted 688
2 SASI_Mm01_00139584 predicted 1304
3 SASI_Mm01_00139585 predicted 313
4 SASI_Mm01_00139586 predicted 787
5 SASI_Mm01_00139587 predicted 616
6 SASI_Mm01_00139588 predicted 988
7 SASI_Mm01_00139589 predicted 259
8 SASI_Mm01_00139590 predicted 1242
9 SASI_Mm01_00139591 predicted 707
10 SASI_Mm01_00139592 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033197
BPIFB1 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1117s21c1
Sequence:CCGGCAAGCATCGGGCTGATCAATGCTCGAGCATTGATCAGCCCGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-657s21c1
Sequence:CCGGCGCATCCAACTGCTGCATAAGCTCGAGCTTATGCAGCAGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-957s21c1
Sequence:CCGGTCTGCAGCTTCCCTGACAATGCTCGAGCATTGTCAGGGAAGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1328s21c1
Sequence:CCGGCACCAAAGGTGACCAACTTATCTCGAGATAAGTTGGTCACCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1468s1c1
Sequence:CCGGCGAACCAGAATGGCAAATTAACTCGAGTTAATTTGCCATTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1355s1c1
Sequence:CCGGCTTGAATAACATCAGCTCTGACTCGAGTCAGAGCTGATGTTATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-419s1c1
Sequence:CCGGGCTGAAGGTCATCACAGCTAACTCGAGTTAGCTGTGATGACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-422s1c1
Sequence:CCGGGAAGGTCATCACAGCTAACATCTCGAGATGTTAGCTGTGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033197
BPIFB1 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1117s21c1
Sequence:CCGGCAAGCATCGGGCTGATCAATGCTCGAGCATTGATCAGCCCGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-657s21c1
Sequence:CCGGCGCATCCAACTGCTGCATAAGCTCGAGCTTATGCAGCAGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-957s21c1
Sequence:CCGGTCTGCAGCTTCCCTGACAATGCTCGAGCATTGTCAGGGAAGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1328s21c1
Sequence:CCGGCACCAAAGGTGACCAACTTATCTCGAGATAAGTTGGTCACCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1468s1c1
Sequence:CCGGCGAACCAGAATGGCAAATTAACTCGAGTTAATTTGCCATTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1355s1c1
Sequence:CCGGCTTGAATAACATCAGCTCTGACTCGAGTCAGAGCTGATGTTATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-419s1c1
Sequence:CCGGGCTGAAGGTCATCACAGCTAACTCGAGTTAGCTGTGATGACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-422s1c1
Sequence:CCGGGAAGGTCATCACAGCTAACATCTCGAGATGTTAGCTGTGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033197
BPIFB1 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1117s21c1
Sequence:CCGGCAAGCATCGGGCTGATCAATGCTCGAGCATTGATCAGCCCGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-657s21c1
Sequence:CCGGCGCATCCAACTGCTGCATAAGCTCGAGCTTATGCAGCAGTTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-957s21c1
Sequence:CCGGTCTGCAGCTTCCCTGACAATGCTCGAGCATTGTCAGGGAAGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033197.2-1328s21c1
Sequence:CCGGCACCAAAGGTGACCAACTTATCTCGAGATAAGTTGGTCACCTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1468s1c1
Sequence:CCGGCGAACCAGAATGGCAAATTAACTCGAGTTAATTTGCCATTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-1355s1c1
Sequence:CCGGCTTGAATAACATCAGCTCTGACTCGAGTCAGAGCTGATGTTATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-419s1c1
Sequence:CCGGGCTGAAGGTCATCACAGCTAACTCGAGTTAGCTGTGATGACCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033197.2-422s1c1
Sequence:CCGGGAAGGTCATCACAGCTAACATCTCGAGATGTTAGCTGTGATGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153418
BPIFB1 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-456s1c1
Sequence:CCGGGACCATAGTGGAGTTCCAAATCTCGAGATTTGGAACTCCACTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-1353s1c1
Sequence:CCGGCCTGACCAAGATCCTTGAATACTCGAGTATTCAAGGATCTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-370s1c1
Sequence:CCGGGATGTGCAGCCTTCAACTTATCTCGAGATAAGTTGAAGGCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-982s1c1
Sequence:CCGGGCTTGTAATCCTGCTCAGATTCTCGAGAATCTGAGCAGGATTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-1303s1c1
Sequence:CCGGGCTGATGATCTCAGATATCAACTCGAGTTGATATCTGAGATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-796s1c1
Sequence:CCGGCCAGGACAGTAATATCCTGTTCTCGAGAACAGGATATTACTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-850s1c1
Sequence:CCGGGAGGGTAACCAACTGGTTCAACTCGAGTTGAACCAGTTGGTTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-310s1c1
Sequence:CCGGGCACACCGTTCTGAGATACATCTCGAGATGTATCTCAGAACGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-267s1c1
Sequence:CCGGGCAAGATAAGTCTGGCAGTATCTCGAGATACTGCCAGACTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-616s1c1
Sequence:CCGGCTTGGCAAAGAATGTTATGAACTCGAGTTCATAACATTCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153418
BPIFB1 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-456s1c1
Sequence:CCGGGACCATAGTGGAGTTCCAAATCTCGAGATTTGGAACTCCACTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-1353s1c1
Sequence:CCGGCCTGACCAAGATCCTTGAATACTCGAGTATTCAAGGATCTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-370s1c1
Sequence:CCGGGATGTGCAGCCTTCAACTTATCTCGAGATAAGTTGAAGGCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-982s1c1
Sequence:CCGGGCTTGTAATCCTGCTCAGATTCTCGAGAATCTGAGCAGGATTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-1303s1c1
Sequence:CCGGGCTGATGATCTCAGATATCAACTCGAGTTGATATCTGAGATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-796s1c1
Sequence:CCGGCCAGGACAGTAATATCCTGTTCTCGAGAACAGGATATTACTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-850s1c1
Sequence:CCGGGAGGGTAACCAACTGGTTCAACTCGAGTTGAACCAGTTGGTTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-310s1c1
Sequence:CCGGGCACACCGTTCTGAGATACATCTCGAGATGTATCTCAGAACGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-267s1c1
Sequence:CCGGGCAAGATAAGTCTGGCAGTATCTCGAGATACTGCCAGACTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-616s1c1
Sequence:CCGGCTTGGCAAAGAATGTTATGAACTCGAGTTCATAACATTCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153418
BPIFB1 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-456s1c1
Sequence:CCGGGACCATAGTGGAGTTCCAAATCTCGAGATTTGGAACTCCACTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-1353s1c1
Sequence:CCGGCCTGACCAAGATCCTTGAATACTCGAGTATTCAAGGATCTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.2-370s1c1
Sequence:CCGGGATGTGCAGCCTTCAACTTATCTCGAGATAAGTTGAAGGCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-982s1c1
Sequence:CCGGGCTTGTAATCCTGCTCAGATTCTCGAGAATCTGAGCAGGATTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-1303s1c1
Sequence:CCGGGCTGATGATCTCAGATATCAACTCGAGTTGATATCTGAGATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153418.1-796s1c1
Sequence:CCGGCCAGGACAGTAATATCCTGTTCTCGAGAACAGGATATTACTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-850s1c1
Sequence:CCGGGAGGGTAACCAACTGGTTCAACTCGAGTTGAACCAGTTGGTTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-310s1c1
Sequence:CCGGGCACACCGTTCTGAGATACATCTCGAGATGTATCTCAGAACGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-267s1c1
Sequence:CCGGGCAAGATAAGTCTGGCAGTATCTCGAGATACTGCCAGACTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153418.1-616s1c1
Sequence:CCGGCTTGGCAAAGAATGTTATGAACTCGAGTTCATAACATTCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks