EMAIL THIS PAGE TO A FRIEND

BPIFB2

BPI fold containing family B, member 2

Synonyms: BPIL1 C20orf184 LPLUNC2 RYSR dJ726C3.2
UniProtKB ID: Q8N4F0, Q6UWN3, Q6ZME0, Q8NFQ7
Gene ID:
Human(80341) Summary: This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Mouse(66557) BPI fold containing family B, member 2
Rat(296290) BPI fold containing family B, member 2
cow(618574) BPI fold containing family B, member 2
dog(485834) BPI fold containing family B, member 2
domestic cat(101099956) BPI fold containing family B, member 2
sheep(101106611) BPI fold containing family B, member 2
domestic guinea pig(100723024) BPI fold containing family B, member 2
naked mole-rat(101723941) BPI fold containing family B, member 2
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025227 Rosetta Predictions human pricing
NM_001106531 Rosetta Predictions rat pricing
NM_025631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181723 predicted 540
2 SASI_Hs01_00181724 predicted 1047
3 SASI_Hs02_00358028 predicted 392
4 SASI_Hs01_00181725 predicted 1385
5 SASI_Hs01_00181726 predicted 620
6 SASI_Hs01_00181728 predicted 1367
7 SASI_Hs01_00181729 predicted 1237
8 SASI_Hs01_00181730 predicted 818
9 SASI_Hs02_00358029 predicted 808
10 SASI_Hs01_00181731 predicted 271
11 SASI_Hs01_00181722 predicted 1482
12 SASI_Hs01_00181727 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219878 predicted 1115
2 SASI_Rn02_00219879 predicted 1667
3 SASI_Rn02_00219880 predicted 596
4 SASI_Rn02_00219881 predicted 552
5 SASI_Rn02_00219882 predicted 1102
6 SASI_Rn02_00219883 predicted 743
7 SASI_Rn02_00219884 predicted 787
8 SASI_Rn02_00219885 predicted 717
9 SASI_Rn02_00219886 predicted 1655
10 SASI_Rn02_00219887 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191052 predicted 678
2 SASI_Mm01_00191053 predicted 1477
3 SASI_Mm01_00191054 predicted 1267
4 SASI_Mm01_00191055 predicted 1280
5 SASI_Mm01_00191056 predicted 444
6 SASI_Mm01_00191057 predicted 716
7 SASI_Mm01_00191058 predicted 1474
8 SASI_Mm01_00191060 predicted 562
9 SASI_Mm01_00191061 predicted 1249
10 SASI_Mm02_00328692 predicted 1014
11 SASI_Mm01_00191059 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025227
BPIFB2 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025227.1-1612s1c1
Sequence:CCGGGCTCAGGCGAATTTCTCATTTCTCGAGAAATGAGAAATTCGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-434s1c1
Sequence:CCGGCCTGAAATTCATTGCTGGTTTCTCGAGAAACCAGCAATGAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-1514s1c1
Sequence:CCGGGATCTTTGTCTATGAGGGCTACTCGAGTAGCCCTCATAGACAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-1370s21c1
Sequence:CCGGCAACGTGGGCTTCATTGATACCTCGAGGTATCAATGAAGCCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-751s21c1
Sequence:CCGGTCCACCTGGGCACCTTAATTGCTCGAGCAATTAAGGTGCCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-791s21c1
Sequence:CCGGTGAGTCCCAGATCCGCTATTCCTCGAGGAATAGCGGATCTGGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-464s21c1
Sequence:CCGGCCTGCTGGCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025227
BPIFB2 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025227.1-1612s1c1
Sequence:CCGGGCTCAGGCGAATTTCTCATTTCTCGAGAAATGAGAAATTCGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-434s1c1
Sequence:CCGGCCTGAAATTCATTGCTGGTTTCTCGAGAAACCAGCAATGAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-1514s1c1
Sequence:CCGGGATCTTTGTCTATGAGGGCTACTCGAGTAGCCCTCATAGACAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-1370s21c1
Sequence:CCGGCAACGTGGGCTTCATTGATACCTCGAGGTATCAATGAAGCCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-751s21c1
Sequence:CCGGTCCACCTGGGCACCTTAATTGCTCGAGCAATTAAGGTGCCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-791s21c1
Sequence:CCGGTGAGTCCCAGATCCGCTATTCCTCGAGGAATAGCGGATCTGGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-464s21c1
Sequence:CCGGCCTGCTGGCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025227
BPIFB2 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025227.1-1612s1c1
Sequence:CCGGGCTCAGGCGAATTTCTCATTTCTCGAGAAATGAGAAATTCGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-434s1c1
Sequence:CCGGCCTGAAATTCATTGCTGGTTTCTCGAGAAACCAGCAATGAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025227.1-1514s1c1
Sequence:CCGGGATCTTTGTCTATGAGGGCTACTCGAGTAGCCCTCATAGACAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-1370s21c1
Sequence:CCGGCAACGTGGGCTTCATTGATACCTCGAGGTATCAATGAAGCCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-751s21c1
Sequence:CCGGTCCACCTGGGCACCTTAATTGCTCGAGCAATTAAGGTGCCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-791s21c1
Sequence:CCGGTGAGTCCCAGATCCGCTATTCCTCGAGGAATAGCGGATCTGGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025227.1-464s21c1
Sequence:CCGGCCTGCTGGCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025631
BPIFB2 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025631.1-1525s1c1
Sequence:CCGGGCATCAAGTCATCATCAGCAACTCGAGTTGCTGATGATGACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-230s1c1
Sequence:CCGGGCAGGTCACTATCTCTGATTTCTCGAGAAATCAGAGATAGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-935s1c1
Sequence:CCGGGCAGCTGAATTCGAAGAACAACTCGAGTTGTTCTTCGAATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1295s1c1
Sequence:CCGGCACACTCATAAGCACCGTATTCTCGAGAATACGGTGCTTATGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1293s1c1
Sequence:CCGGCTCACACTCATAAGCACCGTACTCGAGTACGGTGCTTATGAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025631
BPIFB2 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025631.1-1525s1c1
Sequence:CCGGGCATCAAGTCATCATCAGCAACTCGAGTTGCTGATGATGACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-230s1c1
Sequence:CCGGGCAGGTCACTATCTCTGATTTCTCGAGAAATCAGAGATAGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-935s1c1
Sequence:CCGGGCAGCTGAATTCGAAGAACAACTCGAGTTGTTCTTCGAATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1295s1c1
Sequence:CCGGCACACTCATAAGCACCGTATTCTCGAGAATACGGTGCTTATGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1293s1c1
Sequence:CCGGCTCACACTCATAAGCACCGTACTCGAGTACGGTGCTTATGAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025631
BPIFB2 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025631.1-1525s1c1
Sequence:CCGGGCATCAAGTCATCATCAGCAACTCGAGTTGCTGATGATGACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-230s1c1
Sequence:CCGGGCAGGTCACTATCTCTGATTTCTCGAGAAATCAGAGATAGTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-935s1c1
Sequence:CCGGGCAGCTGAATTCGAAGAACAACTCGAGTTGTTCTTCGAATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1295s1c1
Sequence:CCGGCACACTCATAAGCACCGTATTCTCGAGAATACGGTGCTTATGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025631.1-1293s1c1
Sequence:CCGGCTCACACTCATAAGCACCGTACTCGAGTACGGTGCTTATGAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks