EMAIL THIS PAGE TO A FRIEND

BPIFB3

BPI fold containing family B, member 3

45 Gene Product Result for
Synonyms: C20orf185 LPLUNC3 RYA3 dJ726C3.4
UniProtKB ID: P59826, Q5TDX7
Gene ID:
Mouse(378700) BPI fold containing family B, member 3
Rat(499924) BPI fold containing family B, member 3
naked mole-rat(101706122) BPI fold containing family B, member 3
domestic guinea pig(100727254) BPI fold containing family B, member 3
sheep(101107120) BPI fold containing family B, member 3
cow(522020) BPI fold containing family B, member 3
domestic cat(101092018) BPI fold containing family B, member 3
dog(485835) BPI fold containing family B, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182658 Rosetta Predictions human pricing
NM_001109208 Rosetta Predictions rat pricing
NM_194357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011918 predicted 1084
2 SASI_Hs01_00011920 predicted 303
3 SASI_Hs02_00370811 predicted 705
4 SASI_Hs01_00011921 predicted 731
5 SASI_Hs01_00011922 predicted 1117
6 SASI_Hs02_00370812 predicted 264
7 SASI_Hs01_00011923 predicted 819
8 SASI_Hs01_00011924 predicted 354
9 SASI_Hs01_00011925 predicted 1222
10 SASI_Hs01_00011926 predicted 1134
11 SASI_Hs01_00011919 predicted 470
12 SASI_Hs01_00011927 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246160 predicted 841
2 SASI_Rn02_00246161 predicted 802
3 SASI_Rn02_00246162 predicted 1522
4 SASI_Rn02_00246163 predicted 1464
5 SASI_Rn02_00246164 predicted 401
6 SASI_Rn02_00246165 predicted 424
7 SASI_Rn02_00246166 predicted 508
8 SASI_Rn02_00246167 predicted 715
9 SASI_Rn02_00246168 predicted 819
10 SASI_Rn02_00246169 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124469 predicted 1524
2 SASI_Mm01_00124470 predicted 428
3 SASI_Mm01_00124471 predicted 665
4 SASI_Mm01_00124472 predicted 850
5 SASI_Mm01_00124473 predicted 996
6 SASI_Mm01_00124475 predicted 859
7 SASI_Mm01_00124476 predicted 1481
8 SASI_Mm01_00124477 predicted 1502
9 SASI_Mm01_00124478 predicted 885
10 SASI_Mm02_00350636 predicted 1579
11 SASI_Mm01_00124474 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182658
BPIFB3 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1041s21c1
Sequence:CCGGCACGGTCACACTCCACAACAACTCGAGTTGTTGTGGAGTGTGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1252s21c1
Sequence:CCGGGCCTTTGACGGATCGCGTTTACTCGAGTAAACGCGATCCGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-931s21c1
Sequence:CCGGAGCGATGTCCCACTGACAACTCTCGAGAGTTGTCAGTGGGACATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-96s21c1
Sequence:CCGGTCGGATTGACAAGGATGAACTCTCGAGAGTTCATCCTTGTCAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1085s1c1
Sequence:CCGGCCAACATCCATGTGCTGTTCTCTCGAGAGAACAGCACATGGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-555s1c1
Sequence:CCGGCGTGGAACAGATGCTCTTCAACTCGAGTTGAAGAGCATCTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1300s1c1
Sequence:CCGGGCAGTGTATGCACCAAAGCTTCTCGAGAAGCTTTGGTGCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-753s1c1
Sequence:CCGGGAAGAGTGTAGCTGGTGATATCTCGAGATATCACCAGCTACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182658
BPIFB3 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1041s21c1
Sequence:CCGGCACGGTCACACTCCACAACAACTCGAGTTGTTGTGGAGTGTGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1252s21c1
Sequence:CCGGGCCTTTGACGGATCGCGTTTACTCGAGTAAACGCGATCCGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-931s21c1
Sequence:CCGGAGCGATGTCCCACTGACAACTCTCGAGAGTTGTCAGTGGGACATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-96s21c1
Sequence:CCGGTCGGATTGACAAGGATGAACTCTCGAGAGTTCATCCTTGTCAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1085s1c1
Sequence:CCGGCCAACATCCATGTGCTGTTCTCTCGAGAGAACAGCACATGGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-555s1c1
Sequence:CCGGCGTGGAACAGATGCTCTTCAACTCGAGTTGAAGAGCATCTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1300s1c1
Sequence:CCGGGCAGTGTATGCACCAAAGCTTCTCGAGAAGCTTTGGTGCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-753s1c1
Sequence:CCGGGAAGAGTGTAGCTGGTGATATCTCGAGATATCACCAGCTACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182658
BPIFB3 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1041s21c1
Sequence:CCGGCACGGTCACACTCCACAACAACTCGAGTTGTTGTGGAGTGTGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-1252s21c1
Sequence:CCGGGCCTTTGACGGATCGCGTTTACTCGAGTAAACGCGATCCGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-931s21c1
Sequence:CCGGAGCGATGTCCCACTGACAACTCTCGAGAGTTGTCAGTGGGACATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182658.1-96s21c1
Sequence:CCGGTCGGATTGACAAGGATGAACTCTCGAGAGTTCATCCTTGTCAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1085s1c1
Sequence:CCGGCCAACATCCATGTGCTGTTCTCTCGAGAGAACAGCACATGGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-555s1c1
Sequence:CCGGCGTGGAACAGATGCTCTTCAACTCGAGTTGAAGAGCATCTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-1300s1c1
Sequence:CCGGGCAGTGTATGCACCAAAGCTTCTCGAGAAGCTTTGGTGCATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182658.1-753s1c1
Sequence:CCGGGAAGAGTGTAGCTGGTGATATCTCGAGATATCACCAGCTACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194357
BPIFB3 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194357.1-1647s1c1
Sequence:CCGGCCTGCATTGGTGACAGTATAACTCGAGTTATACTGTCACCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-839s1c1
Sequence:CCGGCCTAATCTCCAACCAGTACATCTCGAGATGTACTGGTTGGAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-225s1c1
Sequence:CCGGGCTCGGATTGACAAGGATGAACTCGAGTTCATCCTTGTCAATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-1481s1c1
Sequence:CCGGGCCTAAGATTCTCAATGTCAACTCGAGTTGACATTGAGAATCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-672s1c1
Sequence:CCGGCCAATCTTTGGGCTCGTAGAACTCGAGTTCTACGAGCCCAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194357
BPIFB3 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194357.1-1647s1c1
Sequence:CCGGCCTGCATTGGTGACAGTATAACTCGAGTTATACTGTCACCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-839s1c1
Sequence:CCGGCCTAATCTCCAACCAGTACATCTCGAGATGTACTGGTTGGAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-225s1c1
Sequence:CCGGGCTCGGATTGACAAGGATGAACTCGAGTTCATCCTTGTCAATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-1481s1c1
Sequence:CCGGGCCTAAGATTCTCAATGTCAACTCGAGTTGACATTGAGAATCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-672s1c1
Sequence:CCGGCCAATCTTTGGGCTCGTAGAACTCGAGTTCTACGAGCCCAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194357
BPIFB3 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194357.1-1647s1c1
Sequence:CCGGCCTGCATTGGTGACAGTATAACTCGAGTTATACTGTCACCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-839s1c1
Sequence:CCGGCCTAATCTCCAACCAGTACATCTCGAGATGTACTGGTTGGAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-225s1c1
Sequence:CCGGGCTCGGATTGACAAGGATGAACTCGAGTTCATCCTTGTCAATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-1481s1c1
Sequence:CCGGGCCTAAGATTCTCAATGTCAACTCGAGTTGACATTGAGAATCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194357.1-672s1c1
Sequence:CCGGCCAATCTTTGGGCTCGTAGAACTCGAGTTCTACGAGCCCAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks