EMAIL THIS PAGE TO A FRIEND

BPIFB4

BPI fold containing family B, member 4

63 Gene Product Result for
Synonyms: C20orf186 LPLUNC4 RY2G5 dJ726C3.5
UniProtKB ID: P59827, Q5TDX6
Gene ID:
Mouse(381399) BPI fold containing family B, member 4
Rat(499925) BPI fold containing family B, member 4
chicken(428160) BPI fold containing family B, member 4
domestic cat(101091778) BPI fold containing family B, member 4
cow(515830) BPI fold containing family B, member 4
dog(477193) BPI fold containing family B, member 4
sheep(101107375) BPI fold containing family B, member 4
domestic guinea pig(100716571) BPI fold containing family B, member 4
naked mole-rat(101723224) BPI fold containing family B, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182519 Rosetta Predictions human pricing
NM_001034875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044711 predicted 1450
2 SASI_Hs01_00044712 predicted 813
3 SASI_Hs01_00044713 predicted 1538
4 SASI_Hs01_00044714 predicted 739
5 SASI_Hs01_00044715 predicted 1604
6 SASI_Hs01_00044716 predicted 1547
7 SASI_Hs01_00044718 predicted 744
8 SASI_Hs01_00044719 predicted 644
9 SASI_Hs01_00044720 predicted 1455
10 SASI_Hs02_00370606 predicted 736
11 SASI_Hs01_00044717 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054440 predicted 390
2 SASI_Mm01_00054441 predicted 930
3 SASI_Mm01_00054442 predicted 989
4 SASI_Mm01_00054443 predicted 768
5 SASI_Mm01_00054444 predicted 1112
6 SASI_Mm01_00054445 predicted 700
7 SASI_Mm01_00054446 predicted 1105
8 SASI_Mm01_00054447 predicted 935
9 SASI_Mm01_00054448 predicted 1225
10 SASI_Mm02_00289148 predicted 254
11 SASI_Mm01_00054449 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182519
BPIFB4 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1671s1c1
Sequence:CCGGCGACTTTAGCAATGCAGACATCTCGAGATGTCTGCATTGCTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1554s1c1
Sequence:CCGGCAACTTTGATATTGGCCTCATCTCGAGATGAGGCCAATATCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1680s1c1
Sequence:CCGGCAATGCAGACATTGACGTGTTCTCGAGAACACGTCAATGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-657s1c1
Sequence:CCGGCGGGAAGAGTCTTATTGGCTTCTCGAGAAGCCAATAAGACTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-949s21c1
Sequence:CCGGCCCAATCTCGTGGACAATTTACTCGAGTAAATTGTCCACGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-257s21c1
Sequence:CCGGTTGATGGTATTTACCAGTATGCTCGAGCATACTGGTAAATACCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-188s21c1
Sequence:CCGGTTGGTGATATTCCCTACAATGCTCGAGCATTGTAGGGAATATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-1183s21c1
Sequence:CCAGGGACTCATCGACTACCCATTGCTCGAGCAATGGGTAGTCGATGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-385s21c1
Sequence:CCGGCGCAGTGCCGAGAATGCATATCTCGAGATATGCATTCTCGGCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182519
BPIFB4 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1671s1c1
Sequence:CCGGCGACTTTAGCAATGCAGACATCTCGAGATGTCTGCATTGCTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1554s1c1
Sequence:CCGGCAACTTTGATATTGGCCTCATCTCGAGATGAGGCCAATATCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1680s1c1
Sequence:CCGGCAATGCAGACATTGACGTGTTCTCGAGAACACGTCAATGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-657s1c1
Sequence:CCGGCGGGAAGAGTCTTATTGGCTTCTCGAGAAGCCAATAAGACTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-949s21c1
Sequence:CCGGCCCAATCTCGTGGACAATTTACTCGAGTAAATTGTCCACGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-257s21c1
Sequence:CCGGTTGATGGTATTTACCAGTATGCTCGAGCATACTGGTAAATACCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-188s21c1
Sequence:CCGGTTGGTGATATTCCCTACAATGCTCGAGCATTGTAGGGAATATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-1183s21c1
Sequence:CCAGGGACTCATCGACTACCCATTGCTCGAGCAATGGGTAGTCGATGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-385s21c1
Sequence:CCGGCGCAGTGCCGAGAATGCATATCTCGAGATATGCATTCTCGGCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182519
BPIFB4 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1671s1c1
Sequence:CCGGCGACTTTAGCAATGCAGACATCTCGAGATGTCTGCATTGCTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1554s1c1
Sequence:CCGGCAACTTTGATATTGGCCTCATCTCGAGATGAGGCCAATATCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-1680s1c1
Sequence:CCGGCAATGCAGACATTGACGTGTTCTCGAGAACACGTCAATGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182519.1-657s1c1
Sequence:CCGGCGGGAAGAGTCTTATTGGCTTCTCGAGAAGCCAATAAGACTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-949s21c1
Sequence:CCGGCCCAATCTCGTGGACAATTTACTCGAGTAAATTGTCCACGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-257s21c1
Sequence:CCGGTTGATGGTATTTACCAGTATGCTCGAGCATACTGGTAAATACCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-188s21c1
Sequence:CCGGTTGGTGATATTCCCTACAATGCTCGAGCATTGTAGGGAATATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-1183s21c1
Sequence:CCAGGGACTCATCGACTACCCATTGCTCGAGCAATGGGTAGTCGATGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182519.2-385s21c1
Sequence:CCGGCGCAGTGCCGAGAATGCATATCTCGAGATATGCATTCTCGGCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034875
BPIFB4 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-63s21c1
Sequence:CCGGGTTGCGCATCGTGGAACTTACCTCGAGGTAAGTTCCACGATGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-184s21c1
Sequence:CCGGGATATTGCAGTGGAGGTAAACCTCGAGGTTTACCTCCACTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034875.2-1307s21c1
Sequence:CCGGCAAGTCTCTTCAGCCTTTATCCTCGAGGATAAAGGCTGAAGAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-1098s21c1
Sequence:CCGGGATCTTTGACCTAGCGTTTATCTCGAGATAAACGCTAGGTCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-508s21c1
Sequence:CCGGTTCCTTGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034875
BPIFB4 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-63s21c1
Sequence:CCGGGTTGCGCATCGTGGAACTTACCTCGAGGTAAGTTCCACGATGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-184s21c1
Sequence:CCGGGATATTGCAGTGGAGGTAAACCTCGAGGTTTACCTCCACTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034875.2-1307s21c1
Sequence:CCGGCAAGTCTCTTCAGCCTTTATCCTCGAGGATAAAGGCTGAAGAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-1098s21c1
Sequence:CCGGGATCTTTGACCTAGCGTTTATCTCGAGATAAACGCTAGGTCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-508s21c1
Sequence:CCGGTTCCTTGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034875
BPIFB4 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-63s21c1
Sequence:CCGGGTTGCGCATCGTGGAACTTACCTCGAGGTAAGTTCCACGATGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-184s21c1
Sequence:CCGGGATATTGCAGTGGAGGTAAACCTCGAGGTTTACCTCCACTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034875.2-1307s21c1
Sequence:CCGGCAAGTCTCTTCAGCCTTTATCCTCGAGGATAAAGGCTGAAGAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-1098s21c1
Sequence:CCGGGATCTTTGACCTAGCGTTTATCTCGAGATAAACGCTAGGTCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034875.2-508s21c1
Sequence:CCGGTTCCTTGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks