EMAIL THIS PAGE TO A FRIEND

BPIFB6

BPI fold containing family B, member 6

44 Gene Product Result for
Synonyms: BPIL3 LPLUNC6
UniProtKB ID: Q8NFQ5
Gene ID:
Mouse(228796) BPI fold containing family B, member 6
Rat(311558) BPI fold containing family B, member 6
cow(518569) BPI fold containing family B, member 6
domestic cat(101092260) BPI fold containing family B, member 6
dog(609958) BPI fold containing family B, member 6
domestic guinea pig(100726143) BPI fold containing family B, member 6
naked mole-rat(101723581) BPI fold containing family B, member 6
sheep(101106867) BPI fold containing family B, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174897 Rosetta Predictions human pricing
NM_001107791 Rosetta Predictions rat pricing
NM_199303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173456 predicted 274
2 SASI_Hs02_00368783 predicted 920
3 SASI_Hs01_00173457 predicted 866
4 SASI_Hs01_00173458 predicted 591
5 SASI_Hs01_00173459 predicted 530
6 SASI_Hs01_00173460 predicted 1121
7 SASI_Hs01_00173461 predicted 601
8 SASI_Hs01_00173462 predicted 315
9 SASI_Hs01_00173463 predicted 728
10 SASI_Hs01_00173464 predicted 1060
11 SASI_Hs01_00173465 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232305 predicted 215
2 SASI_Rn02_00232306 predicted 300
3 SASI_Rn02_00232307 predicted 309
4 SASI_Rn02_00232308 predicted 256
5 SASI_Rn02_00232309 predicted 305
6 SASI_Rn02_00232310 predicted 254
7 SASI_Rn02_00232311 predicted 214
8 SASI_Rn02_00232312 predicted 327
9 SASI_Rn02_00232313 predicted 329
10 SASI_Rn02_00232314 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158960 predicted 368
2 SASI_Mm01_00158961 predicted 1146
3 SASI_Mm01_00158963 predicted 730
4 SASI_Mm02_00351429 predicted 324
5 SASI_Mm01_00158964 predicted 1259
6 SASI_Mm01_00158965 predicted 1365
7 SASI_Mm01_00158966 predicted 1060
8 SASI_Mm01_00158967 predicted 829
9 SASI_Mm01_00158968 predicted 493
10 SASI_Mm01_00158969 predicted 335
11 SASI_Mm01_00158962 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199303
BPIFB6 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-338s1c1
Sequence:CCGGCCTCAGCAATATGAAGGTAAACTCGAGTTTACCTTCATATTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-371s1c1
Sequence:CCGGGCCTGTTATCACATTGAACTTCTCGAGAAGTTCAATGTGATAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1261s1c1
Sequence:CCGGTCACCTCTATGGACAGTTTATCTCGAGATAAACTGTCCATAGAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1260s1c1
Sequence:CCGGGTCACCTCTATGGACAGTTTACTCGAGTAAACTGTCCATAGAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1413s1c1
Sequence:CCGGCCAGACCTTCTGGCTATCAATCTCGAGATTGATAGCCAGAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-1315s21c1
Sequence:CCGGATTTCCACGAGGCGGAGTTAACTCGAGTTAACTCCGCCTCGTGGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-734s21c1
Sequence:CCGGCAAGATGGGCACTGTCAAATACTCGAGTATTTGACAGTGCCCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199303
BPIFB6 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-338s1c1
Sequence:CCGGCCTCAGCAATATGAAGGTAAACTCGAGTTTACCTTCATATTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-371s1c1
Sequence:CCGGGCCTGTTATCACATTGAACTTCTCGAGAAGTTCAATGTGATAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1261s1c1
Sequence:CCGGTCACCTCTATGGACAGTTTATCTCGAGATAAACTGTCCATAGAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1260s1c1
Sequence:CCGGGTCACCTCTATGGACAGTTTACTCGAGTAAACTGTCCATAGAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1413s1c1
Sequence:CCGGCCAGACCTTCTGGCTATCAATCTCGAGATTGATAGCCAGAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-1315s21c1
Sequence:CCGGATTTCCACGAGGCGGAGTTAACTCGAGTTAACTCCGCCTCGTGGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-734s21c1
Sequence:CCGGCAAGATGGGCACTGTCAAATACTCGAGTATTTGACAGTGCCCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199303
BPIFB6 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-338s1c1
Sequence:CCGGCCTCAGCAATATGAAGGTAAACTCGAGTTTACCTTCATATTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-371s1c1
Sequence:CCGGGCCTGTTATCACATTGAACTTCTCGAGAAGTTCAATGTGATAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1261s1c1
Sequence:CCGGTCACCTCTATGGACAGTTTATCTCGAGATAAACTGTCCATAGAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1260s1c1
Sequence:CCGGGTCACCTCTATGGACAGTTTACTCGAGTAAACTGTCCATAGAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199303.1-1413s1c1
Sequence:CCGGCCAGACCTTCTGGCTATCAATCTCGAGATTGATAGCCAGAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-1315s21c1
Sequence:CCGGATTTCCACGAGGCGGAGTTAACTCGAGTTAACTCCGCCTCGTGGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199303.2-734s21c1
Sequence:CCGGCAAGATGGGCACTGTCAAATACTCGAGTATTTGACAGTGCCCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174897
BPIFB6 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family B, member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-933s1c1
Sequence:CCGGGACGACCCAGATCAAGATAAACTCGAGTTTATCTTGATCTGGGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-834s1c1
Sequence:CCGGCCAGGATACAATGATTGGTGACTCGAGTCACCAATCATTGTATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-189s1c1
Sequence:CCGGCATCACCAATTTGAAGGTGAACTCGAGTTCACCTTCAAATTGGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-945s1c1
Sequence:CCGGCAAGATAAAGAAGCCTCCCAACTCGAGTTGGGAGGCTTCTTTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-1077s1c1
Sequence:CCGGCTTCAATCTGAAGGTCCAGTACTCGAGTACTGGACCTTCAGATTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-420s1c1
Sequence:CCGGCCTGGTCAATGTGAAGACTAACTCGAGTTAGTCTTCACATTGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-811s1c1
Sequence:CCGGCAGAAGTCCTTTCATGTGAATCTCGAGATTCACATGAAAGGACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174897
BPIFB6 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family B, member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-933s1c1
Sequence:CCGGGACGACCCAGATCAAGATAAACTCGAGTTTATCTTGATCTGGGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-834s1c1
Sequence:CCGGCCAGGATACAATGATTGGTGACTCGAGTCACCAATCATTGTATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-189s1c1
Sequence:CCGGCATCACCAATTTGAAGGTGAACTCGAGTTCACCTTCAAATTGGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-945s1c1
Sequence:CCGGCAAGATAAAGAAGCCTCCCAACTCGAGTTGGGAGGCTTCTTTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-1077s1c1
Sequence:CCGGCTTCAATCTGAAGGTCCAGTACTCGAGTACTGGACCTTCAGATTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-420s1c1
Sequence:CCGGCCTGGTCAATGTGAAGACTAACTCGAGTTAGTCTTCACATTGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-811s1c1
Sequence:CCGGCAGAAGTCCTTTCATGTGAATCTCGAGATTCACATGAAAGGACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174897
BPIFB6 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family B, member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-933s1c1
Sequence:CCGGGACGACCCAGATCAAGATAAACTCGAGTTTATCTTGATCTGGGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-834s1c1
Sequence:CCGGCCAGGATACAATGATTGGTGACTCGAGTCACCAATCATTGTATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174897.1-189s1c1
Sequence:CCGGCATCACCAATTTGAAGGTGAACTCGAGTTCACCTTCAAATTGGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-945s1c1
Sequence:CCGGCAAGATAAAGAAGCCTCCCAACTCGAGTTGGGAGGCTTCTTTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-1077s1c1
Sequence:CCGGCTTCAATCTGAAGGTCCAGTACTCGAGTACTGGACCTTCAGATTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-420s1c1
Sequence:CCGGCCTGGTCAATGTGAAGACTAACTCGAGTTAGTCTTCACATTGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174897.1-811s1c1
Sequence:CCGGCAGAAGTCCTTTCATGTGAATCTCGAGATTCACATGAAAGGACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)