EMAIL THIS PAGE TO A FRIEND

BPIFC

BPI fold containing family C

Synonyms: BPIL2
UniProtKB ID: Q8NFQ6
Gene ID:
Mouse(270757) BPI fold containing family C
Rat(299685) BPI fold containing family C
dog(474523) BPI fold containing family C
cow(516784) BPI fold containing family C
domestic cat(101090451) BPI fold containing family C
naked mole-rat(101699911) BPI fold containing family C
domestic guinea pig(100714623) BPI fold containing family C
sheep(101118431) BPI fold containing family C
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051431 MISSION® esiRNA esiRNA human BPIL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174932 Rosetta Predictions human pricing
NM_001106773 Rosetta Predictions rat pricing
NM_177772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171669 predicted 680
2 SASI_Hs02_00368863 predicted 830
3 SASI_Hs01_00171670 predicted 691
4 SASI_Hs01_00171671 predicted 1155
5 SASI_Hs01_00171672 predicted 400
6 SASI_Hs01_00171673 predicted 1003
7 SASI_Hs01_00171674 predicted 684
8 SASI_Hs01_00171676 predicted 667
9 SASI_Hs01_00171677 predicted 270
10 SASI_Hs01_00171678 predicted 1137
11 SASI_Hs01_00171675 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222258 predicted 783
2 SASI_Rn02_00222259 predicted 1307
3 SASI_Rn02_00222260 predicted 1044
4 SASI_Rn02_00222261 predicted 1317
5 SASI_Rn02_00222262 predicted 1119
6 SASI_Rn02_00222263 predicted 1170
7 SASI_Rn02_00222264 predicted 1212
8 SASI_Rn02_00222265 predicted 245
9 SASI_Rn02_00222266 predicted 1070
10 SASI_Rn02_00222267 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348157 predicted 221
2 SASI_Mm01_00079970 predicted 764
3 SASI_Mm01_00079971 predicted 1350
4 SASI_Mm02_00348158 predicted 642
5 SASI_Mm01_00079972 predicted 1501
6 SASI_Mm01_00079973 predicted 1590
7 SASI_Mm01_00079974 predicted 251
8 SASI_Mm01_00079975 predicted 1545
9 SASI_Mm02_00348159 predicted 1270
10 SASI_Mm01_00079976 predicted 1121
11 SASI_Mm01_00079969 predicted 1578
12 SASI_Mm01_00079977 predicted 1230
13 SASI_Mm01_00079978 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174932
BPIFC MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-864s21c1
Sequence:CCGGATCTGCGTCCTTTGCTCATTTCTCGAGAAATGAGCAAAGGACGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-589s21c1
Sequence:CCGGGAAATGCTCTGTCCCATTATTCTCGAGAATAATGGGACAGAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-1370s21c1
Sequence:CCGGTATTCGTCAATTCAGATATTGCTCGAGCAATATCTGAATTGACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174932.1-519s1c1
Sequence:CCGGCGGAGAACTCAGTGTTCTGTACTCGAGTACAGAACACTGAGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1139s1c1
Sequence:CCGGCCATGGACTTCGTTGCTAGTACTCGAGTACTAGCAACGAAGTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1282s1c1
Sequence:CCGGCTATCGTCCATTCTTCACTTTCTCGAGAAAGTGAAGAATGGACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-696s1c1
Sequence:CCGGCCTAATCAGTTCTCCAGAAATCTCGAGATTTCTGGAGAACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-408s1c1
Sequence:CCGGCGGAGTCTACTTTACCGGTATCTCGAGATACCGGTAAAGTAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-82s1c1
Sequence:CCGGCCTGGAATCAAGGCAAGGATTCTCGAGAATCCTTGCCTTGATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174932
BPIFC MISSION shRNA shRNA Plasmid DNA
BPI fold containing family C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-864s21c1
Sequence:CCGGATCTGCGTCCTTTGCTCATTTCTCGAGAAATGAGCAAAGGACGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-589s21c1
Sequence:CCGGGAAATGCTCTGTCCCATTATTCTCGAGAATAATGGGACAGAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-1370s21c1
Sequence:CCGGTATTCGTCAATTCAGATATTGCTCGAGCAATATCTGAATTGACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174932.1-519s1c1
Sequence:CCGGCGGAGAACTCAGTGTTCTGTACTCGAGTACAGAACACTGAGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1139s1c1
Sequence:CCGGCCATGGACTTCGTTGCTAGTACTCGAGTACTAGCAACGAAGTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1282s1c1
Sequence:CCGGCTATCGTCCATTCTTCACTTTCTCGAGAAAGTGAAGAATGGACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-696s1c1
Sequence:CCGGCCTAATCAGTTCTCCAGAAATCTCGAGATTTCTGGAGAACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-408s1c1
Sequence:CCGGCGGAGTCTACTTTACCGGTATCTCGAGATACCGGTAAAGTAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-82s1c1
Sequence:CCGGCCTGGAATCAAGGCAAGGATTCTCGAGAATCCTTGCCTTGATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174932
BPIFC MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-864s21c1
Sequence:CCGGATCTGCGTCCTTTGCTCATTTCTCGAGAAATGAGCAAAGGACGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-589s21c1
Sequence:CCGGGAAATGCTCTGTCCCATTATTCTCGAGAATAATGGGACAGAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174932.2-1370s21c1
Sequence:CCGGTATTCGTCAATTCAGATATTGCTCGAGCAATATCTGAATTGACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174932.1-519s1c1
Sequence:CCGGCGGAGAACTCAGTGTTCTGTACTCGAGTACAGAACACTGAGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1139s1c1
Sequence:CCGGCCATGGACTTCGTTGCTAGTACTCGAGTACTAGCAACGAAGTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-1282s1c1
Sequence:CCGGCTATCGTCCATTCTTCACTTTCTCGAGAAAGTGAAGAATGGACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-696s1c1
Sequence:CCGGCCTAATCAGTTCTCCAGAAATCTCGAGATTTCTGGAGAACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-408s1c1
Sequence:CCGGCGGAGTCTACTTTACCGGTATCTCGAGATACCGGTAAAGTAGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174932.1-82s1c1
Sequence:CCGGCCTGGAATCAAGGCAAGGATTCTCGAGAATCCTTGCCTTGATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177772
BPIFC MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177772.2-1673s1c1
Sequence:CCGGCCGTGCATCCTGGATATTAAACTCGAGTTTAATATCCAGGATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-1109s1c1
Sequence:CCGGCCTCCTATGGTCAACTTACAACTCGAGTTGTAAGTTGACCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-942s1c1
Sequence:CCGGCGTCATTTGCTCACTATGTATCTCGAGATACATAGTGAGCAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-941s1c1
Sequence:CCGGGCGTCATTTGCTCACTATGTACTCGAGTACATAGTGAGCAAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-179s1c1
Sequence:CCGGGCACTAGACTATGGTCTTCAACTCGAGTTGAAGACCATAGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177772
BPIFC MISSION shRNA shRNA Plasmid DNA
BPI fold containing family C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177772.2-1673s1c1
Sequence:CCGGCCGTGCATCCTGGATATTAAACTCGAGTTTAATATCCAGGATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-1109s1c1
Sequence:CCGGCCTCCTATGGTCAACTTACAACTCGAGTTGTAAGTTGACCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-942s1c1
Sequence:CCGGCGTCATTTGCTCACTATGTATCTCGAGATACATAGTGAGCAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-941s1c1
Sequence:CCGGGCGTCATTTGCTCACTATGTACTCGAGTACATAGTGAGCAAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-179s1c1
Sequence:CCGGGCACTAGACTATGGTCTTCAACTCGAGTTGAAGACCATAGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177772
BPIFC MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177772.2-1673s1c1
Sequence:CCGGCCGTGCATCCTGGATATTAAACTCGAGTTTAATATCCAGGATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-1109s1c1
Sequence:CCGGCCTCCTATGGTCAACTTACAACTCGAGTTGTAAGTTGACCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-942s1c1
Sequence:CCGGCGTCATTTGCTCACTATGTATCTCGAGATACATAGTGAGCAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-941s1c1
Sequence:CCGGGCGTCATTTGCTCACTATGTACTCGAGTACATAGTGAGCAAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177772.2-179s1c1
Sequence:CCGGGCACTAGACTATGGTCTTCAACTCGAGTTGAAGACCATAGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks