EMAIL THIS PAGE TO A FRIEND

BPNT1

3'(2'), 5'-bisphosphate nucleotidase 1

94 Gene Product Result for
Synonyms: PIP
UniProtKB ID: O95861, A8K7C8, D3DTA9, Q8WVL5, Q9UGJ3
Gene ID:
Human(10380) Summary: BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008]
Mouse(23827) bisphosphate 3'-nucleotidase 1
Rat(64473) 3'(2'), 5'-bisphosphate nucleotidase 1
Zebrafish(436627) bisphosphate nucleotidase 1
cow(521254) 3'(2'), 5'-bisphosphate nucleotidase 1
domestic cat(101095075) 3'(2'), 5'-bisphosphate nucleotidase 1
chicken(421347) 3'(2'), 5'-bisphosphate nucleotidase 1
dog(608525) 3'(2'), 5'-bisphosphate nucleotidase 1
naked mole-rat(101709366) 3'(2'), 5'-bisphosphate nucleotidase 1
domestic guinea pig(100736233) 3'(2'), 5'-bisphosphate nucleotidase 1
sheep(101104841) 3'(2'), 5'-bisphosphate nucleotidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064761 MISSION® esiRNA esiRNA human BPNT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006085 Rosetta Predictions human pricing
NM_171990 Rosetta Predictions rat pricing
NM_011794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186063 predicted 568
2 SASI_Hs01_00186064 predicted 209
3 SASI_Hs01_00186065 predicted 327
4 SASI_Hs01_00186066 predicted 417
5 SASI_Hs01_00186067 predicted 233
6 SASI_Hs02_00340862 predicted 889
7 SASI_Hs01_00186070 predicted 605
8 SASI_Hs01_00186071 predicted 740
9 SASI_Hs02_00340863 predicted 829
10 SASI_Hs01_00186072 predicted 557
11 SASI_Hs01_00186068 predicted 825
12 SASI_Hs01_00186069 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269083 predicted 203
2 SASI_Rn01_00036423 predicted 881
3 SASI_Rn01_00036424 predicted 248
4 SASI_Rn01_00036425 predicted 475
5 SASI_Rn01_00036426 predicted 889
6 SASI_Rn01_00036428 predicted 781
7 SASI_Rn01_00036429 predicted 516
8 SASI_Rn01_00036430 predicted 320
9 SASI_Rn01_00036431 predicted 957
10 SASI_Rn01_00036432 predicted 748
11 SASI_Rn01_00036427 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321451 predicted 1116
2 SASI_Mm02_00321452 predicted 994
3 SASI_Mm02_00321453 predicted 1069
4 SASI_Mm02_00321454 predicted 1067
5 SASI_Mm02_00321455 predicted 1077
6 SASI_Mm02_00321456 predicted 1125
7 SASI_Mm02_00321457 predicted 1181
8 SASI_Mm02_00321458 predicted 1151
9 SASI_Mm02_00321459 predicted 813
10 SASI_Mm02_00321460 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006085
VALIDATED
BPNT1 MISSION shRNA Bacterial Glycerol Stock
3'(2'), 5'-bisphosphate nucleotidase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-1724s1c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-550s1c1
Sequence:CCGGCTTCTTGACAATGTAACAGTTCTCGAGAACTGTTACATTGTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006085.3-755s1c1
Sequence:CCGGCCCATAGCAACAAGTTGGTTACTCGAGTAACCAACTTGTTGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-466s1c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-886s1c1
Sequence:CCGGCCTGGTTGTAAGAAGTGGGATCTCGAGATCCCACTTCTTACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-947s21c1
Sequence:GTACCGGGGAGGCAAGTTAACCGATATCCTCGAGGATATCGGTTAACTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1058s21c1
Sequence:CCGGAGCCGAGTTCCAGAATCTATTCTCGAGAATAGATTCTGGAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-242s21c1
Sequence:CCGGATGATAGTCAGACGTGTTATTCTCGAGAATAACACGTCTGACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-473s21c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1732s21c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-201s21c1
Sequence:CCGGGGTTGGTAGCCTCCGCATATTCTCGAGAATATGCGGAGGCTACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006085
VALIDATED
BPNT1 MISSION shRNA shRNA Plasmid DNA
3'(2'), 5'-bisphosphate nucleotidase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-1724s1c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-550s1c1
Sequence:CCGGCTTCTTGACAATGTAACAGTTCTCGAGAACTGTTACATTGTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006085.3-755s1c1
Sequence:CCGGCCCATAGCAACAAGTTGGTTACTCGAGTAACCAACTTGTTGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-466s1c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-886s1c1
Sequence:CCGGCCTGGTTGTAAGAAGTGGGATCTCGAGATCCCACTTCTTACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-947s21c1
Sequence:GTACCGGGGAGGCAAGTTAACCGATATCCTCGAGGATATCGGTTAACTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1058s21c1
Sequence:CCGGAGCCGAGTTCCAGAATCTATTCTCGAGAATAGATTCTGGAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-242s21c1
Sequence:CCGGATGATAGTCAGACGTGTTATTCTCGAGAATAACACGTCTGACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-473s21c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1732s21c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-201s21c1
Sequence:CCGGGGTTGGTAGCCTCCGCATATTCTCGAGAATATGCGGAGGCTACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006085
VALIDATED
BPNT1 MISSION shRNA Lentiviral Transduction Particles
3'(2'), 5'-bisphosphate nucleotidase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-1724s1c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-550s1c1
Sequence:CCGGCTTCTTGACAATGTAACAGTTCTCGAGAACTGTTACATTGTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006085.3-755s1c1
Sequence:CCGGCCCATAGCAACAAGTTGGTTACTCGAGTAACCAACTTGTTGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-466s1c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006085.3-886s1c1
Sequence:CCGGCCTGGTTGTAAGAAGTGGGATCTCGAGATCCCACTTCTTACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-947s21c1
Sequence:GTACCGGGGAGGCAAGTTAACCGATATCCTCGAGGATATCGGTTAACTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1058s21c1
Sequence:CCGGAGCCGAGTTCCAGAATCTATTCTCGAGAATAGATTCTGGAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-242s21c1
Sequence:CCGGATGATAGTCAGACGTGTTATTCTCGAGAATAACACGTCTGACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-473s21c1
Sequence:CCGGCCATCGCAGTACAGTGCTATTCTCGAGAATAGCACTGTACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006085.4-1732s21c1
Sequence:CCGGCCTATCTTCTAAACCAGATTTCTCGAGAAATCTGGTTTAGAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006085.4-201s21c1
Sequence:CCGGGGTTGGTAGCCTCCGCATATTCTCGAGAATATGCGGAGGCTACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011794
VALIDATED
BPNT1 MISSION shRNA Bacterial Glycerol Stock
3'(2'), 5'-bisphosphate nucleotidase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-153s1c1
Sequence:CCGGCAGCATATTCTATCGCTCAAACTCGAGTTTGAGCGATAGAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-555s1c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-1331s1c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-974s1c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-353s1c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011794.3-1331s21c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-353s21c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-974s21c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-555s21c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011794
VALIDATED
BPNT1 MISSION shRNA shRNA Plasmid DNA
3'(2'), 5'-bisphosphate nucleotidase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-153s1c1
Sequence:CCGGCAGCATATTCTATCGCTCAAACTCGAGTTTGAGCGATAGAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-555s1c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-1331s1c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-974s1c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-353s1c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011794.3-1331s21c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-353s21c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-974s21c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-555s21c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011794
VALIDATED
BPNT1 MISSION shRNA Lentiviral Transduction Particles
3'(2'), 5'-bisphosphate nucleotidase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-153s1c1
Sequence:CCGGCAGCATATTCTATCGCTCAAACTCGAGTTTGAGCGATAGAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-555s1c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-1331s1c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-974s1c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011794.2-353s1c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011794.3-1331s21c1
Sequence:CCGGCCTCCATTACATAGCAAGATACTCGAGTATCTTGCTATGTAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-353s21c1
Sequence:CCGGGAAGTGGATCAAGAGCTGATTCTCGAGAATCAGCTCTTGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-974s21c1
Sequence:CCGGCTGAGGAACTACGAGTACTATCTCGAGATAGTACTCGTAGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011794.3-555s21c1
Sequence:CCGGGCATCATCAACCAGCCGTATTCTCGAGAATACGGCTGGTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks