EMAIL THIS PAGE TO A FRIEND

BPTF

bromodomain PHD finger transcription factor

171 Gene Product Result for
Synonyms: FAC1 FALZ NURF301
UniProtKB ID: Q12830, Q6NX67, Q7Z7D6, Q9UIG2
Gene ID:
Human(2186) Summary: This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
Mouse(207165) bromodomain PHD finger transcription factor
Rat(303617) bromodomain PHD finger transcription factor
Zebrafish(324479) bromodomain PHD finger transcription factor
chicken(100858895) bromodomain PHD finger transcription factor
dog(480467) bromodomain PHD finger transcription factor
domestic cat(101085933) bromodomain PHD finger transcription factor
cow(532986) bromodomain PHD finger transcription factor
Horse(100063881) bromodomain PHD finger transcription factor
domestic guinea pig(100735351) bromodomain PHD finger transcription factor
naked mole-rat(101710448) bromodomain PHD finger transcription factor
sheep(101102998) bromodomain PHD finger transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004459 Rosetta Predictions human pricing
NM_182641 Rosetta Predictions human pricing
NM_001127535 Rosetta Predictions rat pricing
XM_221050 Rosetta Predictions rat pricing
NM_176850 Rosetta Predictions mouse pricing
XM_126724 Rosetta Predictions mouse pricing
XM_903112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230140 predicted 6067
2 SASI_Hs01_00230141 predicted 3573
3 SASI_Hs01_00230143 predicted 5472
4 SASI_Hs02_00337649 predicted 8732
5 SASI_Hs02_00337650 predicted 1064
6 SASI_Hs02_00337651 predicted 3926
7 SASI_Hs01_00230146 predicted 6454
8 SASI_Hs01_00230147 predicted 4430
9 SASI_Hs02_00337652 predicted 5697
10 SASI_Hs02_00337653 predicted 2500
11 SASI_Hs01_00230138 predicted 8606
12 SASI_Hs01_00230139 predicted 5698
13 SASI_Hs01_00230142 predicted 988
14 SASI_Hs01_00230144 predicted 6167
15 SASI_Hs01_00230145 predicted 5264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111280 predicted 5683
2 SASI_Hs01_00111281 predicted 3191
3 SASI_Hs01_00111283 predicted 5095
4 SASI_Hs02_00370794 predicted 8787
5 SASI_Hs02_00370795 predicted 1066
6 SASI_Hs02_00370796 predicted 3552
7 SASI_Hs01_00111286 predicted 6073
8 SASI_Hs01_00111287 predicted 4046
9 SASI_Hs02_00370797 predicted 5319
10 SASI_Hs02_00370798 predicted 2122
11 SASI_Hs01_00111278 predicted 8651
12 SASI_Hs01_00111279 predicted 5320
13 SASI_Hs01_00111282 predicted 988
14 SASI_Hs01_00111284 predicted 5789
15 SASI_Hs01_00111285 predicted 4881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254103 predicted 487
2 SASI_Rn02_00254104 predicted 355
3 SASI_Rn02_00254105 predicted 294
4 SASI_Rn02_00254106 predicted 276
5 SASI_Rn02_00254107 predicted 750
6 SASI_Rn02_00254108 predicted 314
7 SASI_Rn02_00254109 predicted 493
8 SASI_Rn02_00254110 predicted 284
9 SASI_Rn02_00254111 predicted 708
10 SASI_Rn02_00254112 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179847 predicted 4031
2 SASI_Rn01_00179848 predicted 10870
3 SASI_Rn01_00179849 predicted 6470
4 SASI_Rn01_00179850 predicted 3041
5 SASI_Rn01_00179851 predicted 6448
6 SASI_Rn01_00179852 predicted 815
7 SASI_Rn01_00179853 predicted 6506
8 SASI_Rn01_00179854 predicted 10696
9 SASI_Rn01_00179855 predicted 5637
10 SASI_Rn01_00179856 predicted 4609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346769 predicted 5317
2 SASI_Mm02_00346770 predicted 1523
3 SASI_Mm02_00346771 predicted 1620
4 SASI_Mm02_00346772 predicted 5286
5 SASI_Mm02_00346773 predicted 5521
6 SASI_Mm02_00346774 predicted 3206
7 SASI_Mm02_00346775 predicted 5338
8 SASI_Mm02_00346776 predicted 4334
9 SASI_Mm02_00346777 predicted 1978
10 SASI_Mm02_00346778 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261935 predicted 5980
2 SASI_Mm01_00261936 predicted 5545
3 SASI_Mm01_00261937 predicted 7212
4 SASI_Mm01_00261938 predicted 8466
5 SASI_Mm01_00261939 predicted 8230
6 SASI_Mm01_00261940 predicted 5536
7 SASI_Mm01_00261941 predicted 7897
8 SASI_Mm01_00261942 predicted 8676
9 SASI_Mm01_00261943 predicted 7596
10 SASI_Mm01_00261944 predicted 7669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276155 predicted 8492
2 SASI_Mm01_00276156 predicted 8310
3 SASI_Mm01_00276157 predicted 8441
4 SASI_Mm01_00276158 predicted 8200
5 SASI_Mm01_00276159 predicted 8227
6 SASI_Mm01_00276160 predicted 7880
7 SASI_Mm01_00276161 predicted 6551
8 SASI_Mm01_00276162 predicted 6727
9 SASI_Mm01_00276163 predicted 8395
10 SASI_Mm01_00276164 predicted 6692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004459
BPTF MISSION shRNA Bacterial Glycerol Stock
bromodomain PHD finger transcription factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1127s21c1
Sequence:CCGGCCAGTAGAGAACAAGATCAAACTCGAGTTTGATCTTGTTCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-8409s21c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1709s21c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-3208s21c1
Sequence:CCGGGCCAGGCAATACTAATGTGAACTCGAGTTCACATTAGTATTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8409s1c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-1709s1c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8253s1c1
Sequence:CCGGCGCCTTATGATGAATCTAAATCTCGAGATTTAGATTCATCATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004459
BPTF MISSION shRNA shRNA Plasmid DNA
bromodomain PHD finger transcription factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1127s21c1
Sequence:CCGGCCAGTAGAGAACAAGATCAAACTCGAGTTTGATCTTGTTCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-8409s21c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1709s21c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-3208s21c1
Sequence:CCGGGCCAGGCAATACTAATGTGAACTCGAGTTCACATTAGTATTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8409s1c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-1709s1c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8253s1c1
Sequence:CCGGCGCCTTATGATGAATCTAAATCTCGAGATTTAGATTCATCATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004459
BPTF MISSION shRNA Lentiviral Transduction Particles
bromodomain PHD finger transcription factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1127s21c1
Sequence:CCGGCCAGTAGAGAACAAGATCAAACTCGAGTTTGATCTTGTTCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-8409s21c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-1709s21c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004459.6-3208s21c1
Sequence:CCGGGCCAGGCAATACTAATGTGAACTCGAGTTCACATTAGTATTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8409s1c1
Sequence:CCGGCGCCACTAACAGAGAAGGATTCTCGAGAATCCTTCTCTGTTAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-1709s1c1
Sequence:CCGGGCGGCAGCTAATGAAGAAATTCTCGAGAATTTCTTCATTAGCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004459.5-8253s1c1
Sequence:CCGGCGCCTTATGATGAATCTAAATCTCGAGATTTAGATTCATCATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176850
BPTF MISSION shRNA Bacterial Glycerol Stock
bromodomain PHD finger transcription factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-3232s21c1
Sequence:CCGGGAACGGAGGATTCGACAATTTCTCGAGAAATTGTCGAATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8247s21c1
Sequence:CCGGACCGTACGATGAGTCCAAATTCTCGAGAATTTGGACTCATCGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-541s21c1
Sequence:CCGGGACGACGATGACTCCGATTATCTCGAGATAATCGGAGTCATCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8508s21c1
Sequence:CCGGACCGGATTATTACGGTGTTATCTCGAGATAACACCGTAATAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176850.2-8867s21c1
Sequence:CCGGGACCGTAACCTCGTTCATATTCTCGAGAATATGAACGAGGTTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176850
BPTF MISSION shRNA shRNA Plasmid DNA
bromodomain PHD finger transcription factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-3232s21c1
Sequence:CCGGGAACGGAGGATTCGACAATTTCTCGAGAAATTGTCGAATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8247s21c1
Sequence:CCGGACCGTACGATGAGTCCAAATTCTCGAGAATTTGGACTCATCGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-541s21c1
Sequence:CCGGGACGACGATGACTCCGATTATCTCGAGATAATCGGAGTCATCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8508s21c1
Sequence:CCGGACCGGATTATTACGGTGTTATCTCGAGATAACACCGTAATAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176850.2-8867s21c1
Sequence:CCGGGACCGTAACCTCGTTCATATTCTCGAGAATATGAACGAGGTTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176850
BPTF MISSION shRNA Lentiviral Transduction Particles
bromodomain PHD finger transcription factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-3232s21c1
Sequence:CCGGGAACGGAGGATTCGACAATTTCTCGAGAAATTGTCGAATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8247s21c1
Sequence:CCGGACCGTACGATGAGTCCAAATTCTCGAGAATTTGGACTCATCGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-541s21c1
Sequence:CCGGGACGACGATGACTCCGATTATCTCGAGATAATCGGAGTCATCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176850.2-8508s21c1
Sequence:CCGGACCGGATTATTACGGTGTTATCTCGAGATAACACCGTAATAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176850.2-8867s21c1
Sequence:CCGGGACCGTAACCTCGTTCATATTCTCGAGAATATGAACGAGGTTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks