EMAIL THIS PAGE TO A FRIEND

BPY2

basic charge, Y-linked, 2

14 Gene Product Result for
Synonyms: BPY2A VCY2 VCY2A
Species: Human BPY2(9083)
UniProtKB ID: O14599
Gene ID:
Human(9083) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the copy outside of the palidromic region. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004678 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162457 predicted 662
2 SASI_Hs01_00162458 predicted 688
3 SASI_Hs01_00162459 predicted 664
4 SASI_Hs02_00338110 predicted 644
5 SASI_Hs01_00162460 predicted 667
6 SASI_Hs01_00162461 predicted 357
7 SASI_Hs01_00162463 predicted 354
8 SASI_Hs01_00162464 predicted 641
9 SASI_Hs01_00162465 predicted 668
10 SASI_Hs02_00338111 predicted 691
11 SASI_Hs01_00162462 predicted 361
12 SASI_Hs01_00162466 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004678
BPY2 MISSION shRNA Bacterial Glycerol Stock
basic charge, Y-linked, 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-431s1c1
Sequence:CCGGCATGACATATTGCTTGACAAACTCGAGTTTGTCAAGCAATATGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-588s1c1
Sequence:CCGGCCCAGCATACAAATGAGATTACTCGAGTAATCTCATTTGTATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004678.1-904s1c1
Sequence:CCGGCCAGCTTCAGATACCATGCAACTCGAGTTGCATGGTATCTGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-366s1c1
Sequence:CCGGGCAGGACAGGATCATTACTCTCTCGAGAGAGTAATGATCCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-528s1c1
Sequence:CCGGGTGGGCTTGCTGACATATTATCTCGAGATAATATGTCAGCAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004678.2-470s21c1
Sequence:CCGGTATTCTGCATAGGTTGCTAAACTCGAGTTTAGCAACCTATGCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004678.2-1005s21c1
Sequence:CCGGATGGTTCTCATAGTGGTATAACTCGAGTTATACCACTATGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004678
BPY2 MISSION shRNA shRNA Plasmid DNA
basic charge, Y-linked, 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-431s1c1
Sequence:CCGGCATGACATATTGCTTGACAAACTCGAGTTTGTCAAGCAATATGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-588s1c1
Sequence:CCGGCCCAGCATACAAATGAGATTACTCGAGTAATCTCATTTGTATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004678.1-904s1c1
Sequence:CCGGCCAGCTTCAGATACCATGCAACTCGAGTTGCATGGTATCTGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-366s1c1
Sequence:CCGGGCAGGACAGGATCATTACTCTCTCGAGAGAGTAATGATCCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-528s1c1
Sequence:CCGGGTGGGCTTGCTGACATATTATCTCGAGATAATATGTCAGCAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004678.2-470s21c1
Sequence:CCGGTATTCTGCATAGGTTGCTAAACTCGAGTTTAGCAACCTATGCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004678.2-1005s21c1
Sequence:CCGGATGGTTCTCATAGTGGTATAACTCGAGTTATACCACTATGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004678
BPY2 MISSION shRNA Lentiviral Transduction Particles
basic charge, Y-linked, 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-431s1c1
Sequence:CCGGCATGACATATTGCTTGACAAACTCGAGTTTGTCAAGCAATATGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-588s1c1
Sequence:CCGGCCCAGCATACAAATGAGATTACTCGAGTAATCTCATTTGTATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004678.1-904s1c1
Sequence:CCGGCCAGCTTCAGATACCATGCAACTCGAGTTGCATGGTATCTGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-366s1c1
Sequence:CCGGGCAGGACAGGATCATTACTCTCTCGAGAGAGTAATGATCCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004678.1-528s1c1
Sequence:CCGGGTGGGCTTGCTGACATATTATCTCGAGATAATATGTCAGCAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004678.2-470s21c1
Sequence:CCGGTATTCTGCATAGGTTGCTAAACTCGAGTTTAGCAACCTATGCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004678.2-1005s21c1
Sequence:CCGGATGGTTCTCATAGTGGTATAACTCGAGTTATACCACTATGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks