EMAIL THIS PAGE TO A FRIEND

BPY2B

basic charge, Y-linked, 2B

15 Gene Product Result for
Synonyms: VCY2B
Species: Human BPY2B(442867)
Gene ID:
Human(442867) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the more centromeric copy within the palindrome. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002760 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002760 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222182 predicted 660
2 SASI_Hs01_00222183 predicted 693
3 SASI_Hs01_00222184 predicted 671
4 SASI_Hs01_00222185 predicted 636
5 SASI_Hs01_00222186 predicted 668
6 SASI_Hs01_00222187 predicted 356
7 SASI_Hs01_00222189 predicted 359
8 SASI_Hs01_00222190 predicted 643
9 SASI_Hs01_00222191 predicted 668
10 SASI_Hs02_00304195 predicted 695
11 SASI_Hs01_00222188 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002760
BPY2B MISSION shRNA Bacterial Glycerol Stock
basic charge, Y-linked, 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-581s1c1
Sequence:CCGGGACTAGGCCCAGCATACAAATCTCGAGATTTGTATGCTGGGCCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002760.1-990s1c1
Sequence:CCGGGCCACAAGCAAAGTAATGGTTCTCGAGAACCATTACTTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-427s1c1
Sequence:CCGGGCATCATGACATATTGCTTGACTCGAGTCAAGCAATATGTCATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-532s1c1
Sequence:CCGGGCTTGCTGACATATTATGTGACTCGAGTCACATAATATGTCAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-448s1c1
Sequence:CCGGCAAAGAACCTAAGTGATGTTACTCGAGTAACATCACTTAGGTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-565s1c1
Sequence:CCGGGTGAAGTGACTCTTCTGACTACTCGAGTAGTCAGAAGAGTCACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-587s1c1
Sequence:CCGGGCCCAGCATACAAATGAGATTCTCGAGAATCTCATTTGTATGCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002760
BPY2B MISSION shRNA shRNA Plasmid DNA
basic charge, Y-linked, 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-581s1c1
Sequence:CCGGGACTAGGCCCAGCATACAAATCTCGAGATTTGTATGCTGGGCCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002760.1-990s1c1
Sequence:CCGGGCCACAAGCAAAGTAATGGTTCTCGAGAACCATTACTTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-427s1c1
Sequence:CCGGGCATCATGACATATTGCTTGACTCGAGTCAAGCAATATGTCATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-532s1c1
Sequence:CCGGGCTTGCTGACATATTATGTGACTCGAGTCACATAATATGTCAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-448s1c1
Sequence:CCGGCAAAGAACCTAAGTGATGTTACTCGAGTAACATCACTTAGGTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-565s1c1
Sequence:CCGGGTGAAGTGACTCTTCTGACTACTCGAGTAGTCAGAAGAGTCACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-587s1c1
Sequence:CCGGGCCCAGCATACAAATGAGATTCTCGAGAATCTCATTTGTATGCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002760
BPY2B MISSION shRNA Lentiviral Transduction Particles
basic charge, Y-linked, 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-581s1c1
Sequence:CCGGGACTAGGCCCAGCATACAAATCTCGAGATTTGTATGCTGGGCCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002760.1-990s1c1
Sequence:CCGGGCCACAAGCAAAGTAATGGTTCTCGAGAACCATTACTTTGCTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-427s1c1
Sequence:CCGGGCATCATGACATATTGCTTGACTCGAGTCAAGCAATATGTCATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-532s1c1
Sequence:CCGGGCTTGCTGACATATTATGTGACTCGAGTCACATAATATGTCAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-448s1c1
Sequence:CCGGCAAAGAACCTAAGTGATGTTACTCGAGTAACATCACTTAGGTTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-565s1c1
Sequence:CCGGGTGAAGTGACTCTTCTGACTACTCGAGTAGTCAGAAGAGTCACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002760.1-587s1c1
Sequence:CCGGGCCCAGCATACAAATGAGATTCTCGAGAATCTCATTTGTATGCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)