EMAIL THIS PAGE TO A FRIEND

BPY2C

basic charge, Y-linked, 2C

61 Gene Product Result for
Synonyms: VCY2C
Species: Human BPY2C(442868)
Gene ID:
Human(442868) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the more telomeric copy within the palindrome. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301071 ANTI-VCY2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002761 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002761 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165121 predicted 663
2 SASI_Hs01_00165122 predicted 691
3 SASI_Hs01_00165123 predicted 664
4 SASI_Hs01_00165124 predicted 645
5 SASI_Hs01_00165125 predicted 672
6 SASI_Hs01_00165126 predicted 355
7 SASI_Hs01_00165128 predicted 357
8 SASI_Hs01_00165129 predicted 639
9 SASI_Hs01_00165130 predicted 668
10 SASI_Hs02_00304196 predicted 686
11 SASI_Hs01_00165127 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002761
BPY2C MISSION shRNA Bacterial Glycerol Stock
basic charge, Y-linked, 2C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-754s1c1
Sequence:CCGGGATGATGTCCTGCCCACTAAACTCGAGTTTAGTGGGCAGGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-671s1c1
Sequence:CCGGCAAGCAGCTAAGCAATAGATACTCGAGTATCTATTGCTTAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-592s1c1
Sequence:CCGGGCATACAAATGAGATTATGCTCTCGAGAGCATAATCTCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-908s1c1
Sequence:CCGGCTTCAGATACCATGCAATAATCTCGAGATTATTGCATGGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-497s1c1
Sequence:CCGGGAATGTGAGAAATACCTTGCTCTCGAGAGCAAGGTATTTCTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-682s1c1
Sequence:CCGGGCAATAGATAACATCCATCGTCTCGAGACGATGGATGTTATCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-809s1c1
Sequence:CCGGGTAATGCAACTCTCCTCTTTACTCGAGTAAAGAGGAGAGTTGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-1002s1c1
Sequence:CCGGGTAATGGTTCTCATAGTGGTACTCGAGTACCACTATGAGAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002761
BPY2C MISSION shRNA shRNA Plasmid DNA
basic charge, Y-linked, 2C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-754s1c1
Sequence:CCGGGATGATGTCCTGCCCACTAAACTCGAGTTTAGTGGGCAGGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-671s1c1
Sequence:CCGGCAAGCAGCTAAGCAATAGATACTCGAGTATCTATTGCTTAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-592s1c1
Sequence:CCGGGCATACAAATGAGATTATGCTCTCGAGAGCATAATCTCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-908s1c1
Sequence:CCGGCTTCAGATACCATGCAATAATCTCGAGATTATTGCATGGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-497s1c1
Sequence:CCGGGAATGTGAGAAATACCTTGCTCTCGAGAGCAAGGTATTTCTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-682s1c1
Sequence:CCGGGCAATAGATAACATCCATCGTCTCGAGACGATGGATGTTATCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-809s1c1
Sequence:CCGGGTAATGCAACTCTCCTCTTTACTCGAGTAAAGAGGAGAGTTGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-1002s1c1
Sequence:CCGGGTAATGGTTCTCATAGTGGTACTCGAGTACCACTATGAGAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002761
BPY2C MISSION shRNA Lentiviral Transduction Particles
basic charge, Y-linked, 2C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-754s1c1
Sequence:CCGGGATGATGTCCTGCCCACTAAACTCGAGTTTAGTGGGCAGGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-671s1c1
Sequence:CCGGCAAGCAGCTAAGCAATAGATACTCGAGTATCTATTGCTTAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-592s1c1
Sequence:CCGGGCATACAAATGAGATTATGCTCTCGAGAGCATAATCTCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-908s1c1
Sequence:CCGGCTTCAGATACCATGCAATAATCTCGAGATTATTGCATGGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002761.1-497s1c1
Sequence:CCGGGAATGTGAGAAATACCTTGCTCTCGAGAGCAAGGTATTTCTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-682s1c1
Sequence:CCGGGCAATAGATAACATCCATCGTCTCGAGACGATGGATGTTATCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-809s1c1
Sequence:CCGGGTAATGCAACTCTCCTCTTTACTCGAGTAAAGAGGAGAGTTGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002761.1-1002s1c1
Sequence:CCGGGTAATGGTTCTCATAGTGGTACTCGAGTACCACTATGAGAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks