EMAIL THIS PAGE TO A FRIEND

BRAF

v-raf murine sarcoma viral oncogene homolog B

112 Gene Product Result for
Synonyms: B-RAF1 BRAF1 NS7 RAFB1
Gene ID:
Human(673) Summary: This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(109880) Braf transforming gene
Rat(114486) v-raf murine sarcoma viral oncogene homolog B
Zebrafish(403065) v-raf murine sarcoma viral oncogene homolog B1
cow(536051) v-raf murine sarcoma viral oncogene homolog B
Horse(100065760) v-raf murine sarcoma viral oncogene homolog B1
domestic cat(101092346) v-raf murine sarcoma viral oncogene homolog B1
dog(475526) v-raf murine sarcoma viral oncogene homolog B1
chicken(396239) v-raf murine sarcoma viral oncogene homolog B1
naked mole-rat(101702762) v-raf murine sarcoma viral oncogene homolog B1
domestic guinea pig(100717765) v-raf murine sarcoma viral oncogene homolog B1
sheep(101107438) v-raf murine sarcoma viral oncogene homolog B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305646 ANTI-B-RAF (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306600 ANTI-B-RAF (S445) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306390 ANTI-B-RAF (S601) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB3500499 Anti-B-raf antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB4502855 Anti-B-RAF antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502856 Anti-B-RAF antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502853 Anti-B-RAF, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4502854 Anti-B-RAF, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
B1687 Anti-BRAF (431-445) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412329 ANTI-BRAF antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412330 ANTI-BRAF antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412331 ANTI-BRAF antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412332 ANTI-BRAF antibody produced in mouse clone 3A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412333 ANTI-BRAF antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412334 ANTI-BRAF antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412335 ANTI-BRAF antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412336 ANTI-BRAF antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412337 ANTI-BRAF antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001328 Anti-BRAF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
HPA071048 Anti-BRAF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1302228 ANTI-MOUSE BRAF (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504606 Anti-phospho-B-RAF (pSer446) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301560 Anti-phospho-B-RAF (pSer446) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4504087 Anti-phospho-B-RAF (pSer602) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504086 Anti-phospho-B-RAF (pThr599) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4301252 Anti-phospho-B-RAF (pThr599) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504692 Anti-phospho-B-Raf (pThr753) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301344 Anti-phospho-B-Raf (pThr753) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
WH0000673M1 Monoclonal Anti-BRAF antibody produced in mouse clone 3C6, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing
SAB1403617 Monoclonal Anti-BRAF antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300503 Monoclonal Anti-BRAF antibody produced in mouse clone 1H12, ascites fluid mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AMAB91257 Monoclonal Anti-BRAF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4003, purified immunoglobulin New human
immunohistochemistry, western blot pricing
AMAB91258 Monoclonal Anti-BRAF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4004, purified immunoglobulin New human
immunohistochemistry, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1107 MCF10A Cells B-RAF V600E human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004333 siRNAs that have been validated in the lab human pricing
XM_001070228 Rosetta Predictions rat pricing
XM_231692 Rosetta Predictions rat pricing
NM_139294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004333 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107705 validated 2017
1 SASI_Hs01_00107703 validated 1411
1 SASI_Hs01_00107704 validated 743
2 SASI_Hs02_00337383 predicted 1680
3 SASI_Hs01_00107706 predicted 2028
4 SASI_Hs01_00107707 predicted 1706
5 SASI_Hs02_00337384 predicted 1930
6 SASI_Hs01_00107708 predicted 672
7 SASI_Hs01_00107709 predicted 1956
8 SASI_Hs02_00337385 predicted 1985
9 SASI_Hs02_00337386 predicted 1971
10 SASI_Hs01_00107710 predicted 1332
11 SASI_Hs01_00107711 predicted 399
12 SASI_Hs01_00107712 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330884 predicted 2059
2 SASI_Rn02_00330885 predicted 2310
3 SASI_Rn02_00330886 predicted 1417
4 SASI_Rn02_00330887 predicted 2024
5 SASI_Rn02_00330888 predicted 2324
6 SASI_Rn02_00330889 predicted 920
7 SASI_Rn02_00330890 predicted 1364
8 SASI_Rn02_00330891 predicted 1291
9 SASI_Rn02_00330892 predicted 2247
10 SASI_Rn02_00330893 predicted 2335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386881 predicted 648
2 SASI_Rn02_00386882 predicted 768
3 SASI_Rn02_00386883 predicted 738
4 SASI_Rn02_00386884 predicted 503
5 SASI_Rn02_00386885 predicted 648
6 SASI_Rn02_00386886 predicted 682
7 SASI_Rn02_00386887 predicted 680
8 SASI_Rn02_00386888 predicted 728
9 SASI_Rn02_00386889 predicted 622
10 SASI_Rn02_00386890 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339971 predicted 899
2 SASI_Mm02_00339972 predicted 1919
3 SASI_Mm02_00339973 predicted 796
4 SASI_Mm02_00339974 predicted 1280
5 SASI_Mm02_00339975 predicted 1158
6 SASI_Mm02_00339976 predicted 1652
7 SASI_Mm02_00339977 predicted 2201
8 SASI_Mm02_00339978 predicted 1640
9 SASI_Mm02_00339979 predicted 2107
10 SASI_Mm02_00339980 predicted 2168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004333
VALIDATED
BRAF MISSION shRNA Bacterial Glycerol Stock
v-raf murine sarcoma viral oncogene homolog B
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-236s1c1
Sequence:CCGGGAACATATAGAGGCCCTATTGCTCGAGCAATAGGGCCTCTATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1931s1c1
Sequence:CCGGGTCATCAGAATGCAAGATAAACTCGAGTTTATCTTGCATTCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1960s1c1
Sequence:CCGGCAGCTTTCAGTCAGATGTATACTCGAGTATACATCTGACTGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-2093s1c1
Sequence:CCGGCTCAGTAAGGTACGGAGTAACCTCGAGGTTACTCCGTACCTTACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004333.2-838s1c1
Sequence:CCGGCCGCTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-304s1c1
Sequence:CCGGCTATGAAGAATACACCAGCAACTCGAGTTGCTGGTGTATTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-1538s1c1
Sequence:CCGGCAGCAGTTACAAGCCTTCAAACTCGAGTTTGAAGGCTTGTAACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-2267s1c1
Sequence:CCGGGCTGGTTTCCAAACAGAGGATCTCGAGATCCTCTGTTTGGAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2477s21c1
Sequence:GTACCGGAGAACACTTGTGTGGTTAAAGCTCGAGCTTTAACCACACAAGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2729s21c1
Sequence:GTACCGGCCCTACCTATGCCTGTGTTTGCTCGAGCAAACACAGGCATAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-614s21c1
Sequence:GTACCGGCTGATGATGAGAGGTCTAATCCTCGAGGATTAGACCTCTCATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-1674s21c1
Sequence:GTACCGGATCACCATCTCCATATCATTGCTCGAGCAATGATATGGAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2769s21c1
Sequence:CCGGCGGTTAGCCTGGGTTAGATAACTCGAGTTATCTAACCCAGGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1600s21c1
Sequence:CCGGCCTACTCTTCATGGGCTATTCCTCGAGGAATAGCCCATGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1277s21c1
Sequence:CCGGTTACCTGGCTCACTAACTAACCTCGAGGTTAGTTAGTGAGCCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-684s21c1
Sequence:CCGGTTGGTTGGGACACTGATATTTCTCGAGAAATATCAGTGTCCCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2379s21c1
Sequence:GTACCGGAGTTCAGGAGAGTAGCAACAACTCGAGTTGTTGCTACTCTCCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-2184s21c1
Sequence:GTACCGGCCCAAATTCTCGCCTCTATTGCTCGAGCAATAGAGGCGAGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-274s21c1
Sequence:GTACCGGGCATAATCCACCATCAATATACTCGAGTATATTGATGGTGGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004333
VALIDATED
BRAF MISSION shRNA shRNA Plasmid DNA
v-raf murine sarcoma viral oncogene homolog B
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-236s1c1
Sequence:CCGGGAACATATAGAGGCCCTATTGCTCGAGCAATAGGGCCTCTATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1931s1c1
Sequence:CCGGGTCATCAGAATGCAAGATAAACTCGAGTTTATCTTGCATTCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1960s1c1
Sequence:CCGGCAGCTTTCAGTCAGATGTATACTCGAGTATACATCTGACTGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-2093s1c1
Sequence:CCGGCTCAGTAAGGTACGGAGTAACCTCGAGGTTACTCCGTACCTTACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004333.2-838s1c1
Sequence:CCGGCCGCTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-304s1c1
Sequence:CCGGCTATGAAGAATACACCAGCAACTCGAGTTGCTGGTGTATTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-1538s1c1
Sequence:CCGGCAGCAGTTACAAGCCTTCAAACTCGAGTTTGAAGGCTTGTAACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-2267s1c1
Sequence:CCGGGCTGGTTTCCAAACAGAGGATCTCGAGATCCTCTGTTTGGAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2477s21c1
Sequence:GTACCGGAGAACACTTGTGTGGTTAAAGCTCGAGCTTTAACCACACAAGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2729s21c1
Sequence:GTACCGGCCCTACCTATGCCTGTGTTTGCTCGAGCAAACACAGGCATAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-614s21c1
Sequence:GTACCGGCTGATGATGAGAGGTCTAATCCTCGAGGATTAGACCTCTCATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-1674s21c1
Sequence:GTACCGGATCACCATCTCCATATCATTGCTCGAGCAATGATATGGAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2769s21c1
Sequence:CCGGCGGTTAGCCTGGGTTAGATAACTCGAGTTATCTAACCCAGGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1600s21c1
Sequence:CCGGCCTACTCTTCATGGGCTATTCCTCGAGGAATAGCCCATGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1277s21c1
Sequence:CCGGTTACCTGGCTCACTAACTAACCTCGAGGTTAGTTAGTGAGCCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-684s21c1
Sequence:CCGGTTGGTTGGGACACTGATATTTCTCGAGAAATATCAGTGTCCCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2379s21c1
Sequence:GTACCGGAGTTCAGGAGAGTAGCAACAACTCGAGTTGTTGCTACTCTCCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-2184s21c1
Sequence:GTACCGGCCCAAATTCTCGCCTCTATTGCTCGAGCAATAGAGGCGAGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-274s21c1
Sequence:GTACCGGGCATAATCCACCATCAATATACTCGAGTATATTGATGGTGGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004333
VALIDATED
BRAF MISSION shRNA Lentiviral Transduction Particles
v-raf murine sarcoma viral oncogene homolog B
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-236s1c1
Sequence:CCGGGAACATATAGAGGCCCTATTGCTCGAGCAATAGGGCCTCTATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1931s1c1
Sequence:CCGGGTCATCAGAATGCAAGATAAACTCGAGTTTATCTTGCATTCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-1960s1c1
Sequence:CCGGCAGCTTTCAGTCAGATGTATACTCGAGTATACATCTGACTGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004333.3-2093s1c1
Sequence:CCGGCTCAGTAAGGTACGGAGTAACCTCGAGGTTACTCCGTACCTTACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004333.2-838s1c1
Sequence:CCGGCCGCTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-304s1c1
Sequence:CCGGCTATGAAGAATACACCAGCAACTCGAGTTGCTGGTGTATTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-1538s1c1
Sequence:CCGGCAGCAGTTACAAGCCTTCAAACTCGAGTTTGAAGGCTTGTAACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004333.2-2267s1c1
Sequence:CCGGGCTGGTTTCCAAACAGAGGATCTCGAGATCCTCTGTTTGGAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2477s21c1
Sequence:GTACCGGAGAACACTTGTGTGGTTAAAGCTCGAGCTTTAACCACACAAGTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2729s21c1
Sequence:GTACCGGCCCTACCTATGCCTGTGTTTGCTCGAGCAAACACAGGCATAGGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-614s21c1
Sequence:GTACCGGCTGATGATGAGAGGTCTAATCCTCGAGGATTAGACCTCTCATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-1674s21c1
Sequence:GTACCGGATCACCATCTCCATATCATTGCTCGAGCAATGATATGGAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2769s21c1
Sequence:CCGGCGGTTAGCCTGGGTTAGATAACTCGAGTTATCTAACCCAGGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1600s21c1
Sequence:CCGGCCTACTCTTCATGGGCTATTCCTCGAGGAATAGCCCATGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004333.4-1277s21c1
Sequence:CCGGTTACCTGGCTCACTAACTAACCTCGAGGTTAGTTAGTGAGCCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-684s21c1
Sequence:CCGGTTGGTTGGGACACTGATATTTCTCGAGAAATATCAGTGTCCCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004333.4-2379s21c1
Sequence:GTACCGGAGTTCAGGAGAGTAGCAACAACTCGAGTTGTTGCTACTCTCCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-2184s21c1
Sequence:GTACCGGCCCAAATTCTCGCCTCTATTGCTCGAGCAATAGAGGCGAGAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004333.4-274s21c1
Sequence:GTACCGGGCATAATCCACCATCAATATACTCGAGTATATTGATGGTGGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355754
VALIDATED
BRAF MISSION shRNA Bacterial Glycerol Stock
v-raf murine sarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-477s1c1
Sequence:CCGGCCTGGGTAATGGAGCAGATTTCTCGAGAAATCTGCTCCATTACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-2110s1c1
Sequence:CCGGGCTTACGAGAAATACACTGAACTCGAGTTCAGTGTATTTCTCGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-623s1c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.1-861s1c1
Sequence:CCGGCCCACTTACAACACACAACTTCTCGAGAAGTTGTGTGTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2289s1c1
Sequence:CCGGGCTACCTTATTCAAACATCAACTCGAGTTGATGTTTGAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1797s1c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1213s1c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2341s1c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.2-948s1c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355754
VALIDATED
BRAF MISSION shRNA shRNA Plasmid DNA
v-raf murine sarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-477s1c1
Sequence:CCGGCCTGGGTAATGGAGCAGATTTCTCGAGAAATCTGCTCCATTACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-2110s1c1
Sequence:CCGGGCTTACGAGAAATACACTGAACTCGAGTTCAGTGTATTTCTCGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-623s1c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.1-861s1c1
Sequence:CCGGCCCACTTACAACACACAACTTCTCGAGAAGTTGTGTGTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2289s1c1
Sequence:CCGGGCTACCTTATTCAAACATCAACTCGAGTTGATGTTTGAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1797s1c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1213s1c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2341s1c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.2-948s1c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355754
VALIDATED
BRAF MISSION shRNA Lentiviral Transduction Particles
v-raf murine sarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-477s1c1
Sequence:CCGGCCTGGGTAATGGAGCAGATTTCTCGAGAAATCTGCTCCATTACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-2110s1c1
Sequence:CCGGGCTTACGAGAAATACACTGAACTCGAGTTCAGTGTATTTCTCGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.1-623s1c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.1-861s1c1
Sequence:CCGGCCCACTTACAACACACAACTTCTCGAGAAGTTGTGTGTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2289s1c1
Sequence:CCGGGCTACCTTATTCAAACATCAACTCGAGTTGATGTTTGAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1797s1c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-1213s1c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355754.2-2341s1c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355754.2-948s1c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139294
BRAF MISSION shRNA Bacterial Glycerol Stock
v-raf murine sarcoma viral oncogene homolog B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1162s21c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-897s21c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2290s21c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1902s21c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-572s21c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2235s21c1
Sequence:CCGGCCAGCTACCTTATTCAAACATCTCGAGATGTTTGAATAAGGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139294
BRAF MISSION shRNA shRNA Plasmid DNA
v-raf murine sarcoma viral oncogene homolog B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1162s21c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-897s21c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2290s21c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1902s21c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-572s21c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2235s21c1
Sequence:CCGGCCAGCTACCTTATTCAAACATCTCGAGATGTTTGAATAAGGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139294
BRAF MISSION shRNA Lentiviral Transduction Particles
v-raf murine sarcoma viral oncogene homolog B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1162s21c1
Sequence:CCGGGCAGATGAAGATCATCGCAATCTCGAGATTGCGATGATCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-897s21c1
Sequence:CCGGCCGTTGTCAAACATGTGGTTACTCGAGTAACCACATGTTTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2290s21c1
Sequence:CCGGCGAGGATACCTATCTCCAGATCTCGAGATCTGGAGATAGGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-1902s21c1
Sequence:CCGGCCACATCATTGAGACCAAATTCTCGAGAATTTGGTCTCAATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-572s21c1
Sequence:CCGGCACCACAGAAACCTATCGTTACTCGAGTAACGATAGGTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139294.5-2235s21c1
Sequence:CCGGCCAGCTACCTTATTCAAACATCTCGAGATGTTTGAATAAGGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks