EMAIL THIS PAGE TO A FRIEND

BRAP

BRCA1 associated protein

61 Gene Product Result for
Synonyms: BRAP2 IMP RNF52
UniProtKB ID: Q7Z569, B9EGS8, O43238, O75341
Gene ID:
Human(8315) Summary: The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
Mouse(72399) BRCA1 associated protein
Rat(687346) BRCA1 associated protein
Zebrafish(436739) BRCA1 associated protein
dog(486271) BRCA1 associated protein
cow(518844) BRCA1 associated protein
Horse(100057742) BRCA1 associated protein
domestic cat(101082014) BRCA1 associated protein
chicken(772041) BRCA1 associated protein
naked mole-rat(101708618) BRCA1 associated protein
domestic guinea pig(100729597) BRCA1 associated protein
sheep(101107047) BRCA1 associated protein
Domestic Rabbit(100353809) BRCA1 associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006768 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020871 MISSION® esiRNA esiRNA human BRAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006768 Rosetta Predictions human pricing
XM_001075972 Rosetta Predictions rat pricing
NM_028227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342274 predicted 1548
2 SASI_Hs01_00106776 predicted 578
3 SASI_Hs02_00342275 predicted 2052
4 SASI_Hs02_00342276 predicted 573
5 SASI_Hs01_00106777 predicted 1194
6 SASI_Hs01_00106778 predicted 1206
7 SASI_Hs01_00106779 predicted 1093
8 SASI_Hs01_00106781 predicted 528
9 SASI_Hs01_00106783 predicted 1290
10 SASI_Hs02_00342277 predicted 1990
11 SASI_Hs01_00106780 predicted 400
12 SASI_Hs01_00106782 predicted 684
13 SASI_Hs01_00106784 predicted 553
14 SASI_Hs01_00106785 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351671 predicted 1116
2 SASI_Rn02_00351672 predicted 569
3 SASI_Rn02_00351673 predicted 1372
4 SASI_Rn02_00351674 predicted 755
5 SASI_Rn02_00351675 predicted 1947
6 SASI_Rn02_00351676 predicted 610
7 SASI_Rn02_00351677 predicted 1320
8 SASI_Rn02_00351678 predicted 1500
9 SASI_Rn02_00351679 predicted 494
10 SASI_Rn02_00351680 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122956 predicted 1276
2 SASI_Mm01_00122957 predicted 1370
3 SASI_Mm02_00333551 predicted 697
4 SASI_Mm01_00122958 predicted 589
5 SASI_Mm01_00122959 predicted 577
6 SASI_Mm01_00122961 predicted 2013
7 SASI_Mm01_00122962 predicted 816
8 SASI_Mm01_00122963 predicted 2027
9 SASI_Mm01_00122964 predicted 1321
10 SASI_Mm02_00333552 predicted 385
11 SASI_Mm01_00122955 predicted 763
12 SASI_Mm01_00122960 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006768
VALIDATED
BRAP MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-889s21c1
Sequence:CCGGACGTTTGCCAGCTAGTGTATGCTCGAGCATACACTAGCTGGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1021s21c1
Sequence:CCGGATGGCATCCTCACAACGTTATCTCGAGATAACGTTGTGAGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-782s21c1
Sequence:CCGGCTCTACTCCCAACCAATATATCTCGAGATATATTGGTTGGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006768.3-610s21c1
Sequence:CCGGATGGTATTATGCACCTATATACTCGAGTATATAGGTGCATAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1214s21c1
Sequence:CCGGTGTCAGTCGACATGCTTATAACTCGAGTTATAAGCATGTCGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-428s21c1
Sequence:CCGGGTCCAACCCAGATGAACTAAACTCGAGTTTAGTTCATCTGGGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-3730s21c1
Sequence:CCGGTTCAGTACAGGTGGGATAAATCTCGAGATTTATCCCACCTGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-2412s21c1
Sequence:CCGGGAGGTTTCCATTGGCTATTAACTCGAGTTAATAGCCAATGGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-809s1c1
Sequence:CCGGCGCCAGTTCAACTCAATAGAACTCGAGTTCTATTGAGTTGAACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-296s1c1
Sequence:CCGGCCAGGAGAGAAAGTAGCGATTCTCGAGAATCGCTACTTTCTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-686s1c1
Sequence:CCGGCCATTTAACGACGTAATTGAACTCGAGTTCAATTACGTCGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1347s1c1
Sequence:CCGGCCTTACAGTTAGAGTATTCATCTCGAGATGAATACTCTAACTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1609s1c1
Sequence:CCGGGCAGGAAATGAACAAGTGTTTCTCGAGAAACACTTGTTCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006768
VALIDATED
BRAP MISSION shRNA shRNA Plasmid DNA
BRCA1 associated protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-889s21c1
Sequence:CCGGACGTTTGCCAGCTAGTGTATGCTCGAGCATACACTAGCTGGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1021s21c1
Sequence:CCGGATGGCATCCTCACAACGTTATCTCGAGATAACGTTGTGAGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-782s21c1
Sequence:CCGGCTCTACTCCCAACCAATATATCTCGAGATATATTGGTTGGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006768.3-610s21c1
Sequence:CCGGATGGTATTATGCACCTATATACTCGAGTATATAGGTGCATAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1214s21c1
Sequence:CCGGTGTCAGTCGACATGCTTATAACTCGAGTTATAAGCATGTCGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-428s21c1
Sequence:CCGGGTCCAACCCAGATGAACTAAACTCGAGTTTAGTTCATCTGGGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-3730s21c1
Sequence:CCGGTTCAGTACAGGTGGGATAAATCTCGAGATTTATCCCACCTGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-2412s21c1
Sequence:CCGGGAGGTTTCCATTGGCTATTAACTCGAGTTAATAGCCAATGGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-809s1c1
Sequence:CCGGCGCCAGTTCAACTCAATAGAACTCGAGTTCTATTGAGTTGAACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-296s1c1
Sequence:CCGGCCAGGAGAGAAAGTAGCGATTCTCGAGAATCGCTACTTTCTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-686s1c1
Sequence:CCGGCCATTTAACGACGTAATTGAACTCGAGTTCAATTACGTCGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1347s1c1
Sequence:CCGGCCTTACAGTTAGAGTATTCATCTCGAGATGAATACTCTAACTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1609s1c1
Sequence:CCGGGCAGGAAATGAACAAGTGTTTCTCGAGAAACACTTGTTCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006768
VALIDATED
BRAP MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-889s21c1
Sequence:CCGGACGTTTGCCAGCTAGTGTATGCTCGAGCATACACTAGCTGGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1021s21c1
Sequence:CCGGATGGCATCCTCACAACGTTATCTCGAGATAACGTTGTGAGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-782s21c1
Sequence:CCGGCTCTACTCCCAACCAATATATCTCGAGATATATTGGTTGGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006768.3-610s21c1
Sequence:CCGGATGGTATTATGCACCTATATACTCGAGTATATAGGTGCATAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-1214s21c1
Sequence:CCGGTGTCAGTCGACATGCTTATAACTCGAGTTATAAGCATGTCGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006768.3-428s21c1
Sequence:CCGGGTCCAACCCAGATGAACTAAACTCGAGTTTAGTTCATCTGGGTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-3730s21c1
Sequence:CCGGTTCAGTACAGGTGGGATAAATCTCGAGATTTATCCCACCTGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006768.3-2412s21c1
Sequence:CCGGGAGGTTTCCATTGGCTATTAACTCGAGTTAATAGCCAATGGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-809s1c1
Sequence:CCGGCGCCAGTTCAACTCAATAGAACTCGAGTTCTATTGAGTTGAACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-296s1c1
Sequence:CCGGCCAGGAGAGAAAGTAGCGATTCTCGAGAATCGCTACTTTCTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-686s1c1
Sequence:CCGGCCATTTAACGACGTAATTGAACTCGAGTTCAATTACGTCGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1347s1c1
Sequence:CCGGCCTTACAGTTAGAGTATTCATCTCGAGATGAATACTCTAACTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006768.2-1609s1c1
Sequence:CCGGGCAGGAAATGAACAAGTGTTTCTCGAGAAACACTTGTTCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028227
VALIDATED
BRAP MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1276s21c1
Sequence:CCGGGGACTATGCTGGAGATAATTACTCGAGTAATTATCTCCAGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-2021s21c1
Sequence:CCGGCGGAAGTGTGGGCCCTAATAACTCGAGTTATTAGGGCCCACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1475s21c1
Sequence:CCGGGACACGGCAGAGGAGATTAACCTCGAGGTTAATCTCCTCTGCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1423s21c1
Sequence:CCGGGCTGGAATCGCAGCGGATATACTCGAGTATATCCGCTGCGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028227.2-583s21c1
Sequence:CCGGTGAAATAGTCCACGGCATTATCTCGAGATAATGCCGTGGACTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-364s1c1
Sequence:CCGGCGCCAGTTCAACTCAATCGAACTCGAGTTCGATTGAGTTGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-217s1c1
Sequence:CCGGCATGACCTTATGAAGTTTGTTCTCGAGAACAAACTTCATAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-340s1c1
Sequence:CCGGAGTTTCTACATGGCGTGCAATCTCGAGATTGCACGCCATGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-799s1c1
Sequence:CCGGGCTGGAGATAATTATGTCCATCTCGAGATGGACATAATTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-952s1c1
Sequence:CCGGCGGATATACTGGGAGAACAAACTCGAGTTTGTTCTCCCAGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028227
VALIDATED
BRAP MISSION shRNA shRNA Plasmid DNA
BRCA1 associated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1276s21c1
Sequence:CCGGGGACTATGCTGGAGATAATTACTCGAGTAATTATCTCCAGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-2021s21c1
Sequence:CCGGCGGAAGTGTGGGCCCTAATAACTCGAGTTATTAGGGCCCACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1475s21c1
Sequence:CCGGGACACGGCAGAGGAGATTAACCTCGAGGTTAATCTCCTCTGCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1423s21c1
Sequence:CCGGGCTGGAATCGCAGCGGATATACTCGAGTATATCCGCTGCGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028227.2-583s21c1
Sequence:CCGGTGAAATAGTCCACGGCATTATCTCGAGATAATGCCGTGGACTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-364s1c1
Sequence:CCGGCGCCAGTTCAACTCAATCGAACTCGAGTTCGATTGAGTTGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-217s1c1
Sequence:CCGGCATGACCTTATGAAGTTTGTTCTCGAGAACAAACTTCATAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-340s1c1
Sequence:CCGGAGTTTCTACATGGCGTGCAATCTCGAGATTGCACGCCATGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-799s1c1
Sequence:CCGGGCTGGAGATAATTATGTCCATCTCGAGATGGACATAATTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-952s1c1
Sequence:CCGGCGGATATACTGGGAGAACAAACTCGAGTTTGTTCTCCCAGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028227
VALIDATED
BRAP MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1276s21c1
Sequence:CCGGGGACTATGCTGGAGATAATTACTCGAGTAATTATCTCCAGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-2021s21c1
Sequence:CCGGCGGAAGTGTGGGCCCTAATAACTCGAGTTATTAGGGCCCACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1475s21c1
Sequence:CCGGGACACGGCAGAGGAGATTAACCTCGAGGTTAATCTCCTCTGCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028227.2-1423s21c1
Sequence:CCGGGCTGGAATCGCAGCGGATATACTCGAGTATATCCGCTGCGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028227.2-583s21c1
Sequence:CCGGTGAAATAGTCCACGGCATTATCTCGAGATAATGCCGTGGACTATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-364s1c1
Sequence:CCGGCGCCAGTTCAACTCAATCGAACTCGAGTTCGATTGAGTTGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-217s1c1
Sequence:CCGGCATGACCTTATGAAGTTTGTTCTCGAGAACAAACTTCATAAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-340s1c1
Sequence:CCGGAGTTTCTACATGGCGTGCAATCTCGAGATTGCACGCCATGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-799s1c1
Sequence:CCGGGCTGGAGATAATTATGTCCATCTCGAGATGGACATAATTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028227.1-952s1c1
Sequence:CCGGCGGATATACTGGGAGAACAAACTCGAGTTTGTTCTCCCAGTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks