EMAIL THIS PAGE TO A FRIEND

BRAT1

BRCA1-associated ATM activator 1

93 Gene Product Result for
Synonyms: BAAT1 C7orf27 RMFSL
Gene ID:
Human(221927) Summary: The protein encoded by this ubiquitously expressed gene interacts with the tumor suppressing BRCA1 (breast cancer 1) protein and and the ATM (ataxia telangiectasia mutated) protein. ATM is thought to be a master controller of cell cycle checkpoint signalling pathways that are required for cellular responses to DNA damage such as double-strand breaks that are induced by ionizing radiation and complexes with BRCA1 in the multi-protein complex BASC (BRAC1-associated genome surveillance complex). The protein encoded by this gene is thought to play a role in the DNA damage pathway regulated by BRCA1 and ATM. [provided by RefSeq, Mar 2012]
Mouse(231841) BRCA1-associated ATM activator 1
Rat(498150) BRCA1-associated ATM activator 1
Zebrafish(678547) BRCA1-associated ATM activator 1
dog(609589) BRCA1-associated ATM activator 1
chicken(769893) BRCA1-associated ATM activator 1
cow(532550) BRCA1-associated ATM activator 1
domestic cat(101086524) BRCA1-associated ATM activator 1
sheep(101111600) BRCA1-associated ATM activator 1
domestic guinea pig(100731655) BRCA1-associated ATM activator 1
naked mole-rat(101698169) BRCA1-associated ATM activator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152743 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025571 MISSION® esiRNA esiRNA human C7orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152743 Rosetta Predictions human pricing
XM_001064900 Rosetta Predictions rat pricing
XM_573361 Rosetta Predictions rat pricing
NM_172724 Rosetta Predictions mouse pricing
NM_181066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228825 predicted 2013
2 SASI_Hs01_00228826 predicted 621
3 SASI_Hs01_00228827 predicted 324
4 SASI_Hs01_00228828 predicted 1825
5 SASI_Hs01_00228829 predicted 812
6 SASI_Hs01_00228831 predicted 1521
7 SASI_Hs01_00228832 predicted 626
8 SASI_Hs01_00228833 predicted 2129
9 SASI_Hs01_00228834 predicted 968
10 SASI_Hs02_00366659 predicted 1514
11 SASI_Hs01_00228830 predicted 2194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312180 predicted 2090
2 SASI_Rn02_00312181 predicted 945
3 SASI_Rn02_00312182 predicted 960
4 SASI_Rn02_00312183 predicted 1787
5 SASI_Rn02_00312184 predicted 1345
6 SASI_Rn02_00312185 predicted 1771
7 SASI_Rn02_00312186 predicted 886
8 SASI_Rn02_00312187 predicted 1688
9 SASI_Rn02_00312188 predicted 2454
10 SASI_Rn02_00312189 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146284 predicted 561
2 SASI_Rn01_00146285 predicted 940
3 SASI_Rn01_00146286 predicted 665
4 SASI_Rn01_00146287 predicted 787
5 SASI_Rn01_00146288 predicted 548
6 SASI_Rn01_00146289 predicted 381
7 SASI_Rn01_00146290 predicted 487
8 SASI_Rn01_00146291 predicted 389
9 SASI_Rn01_00146292 predicted 255
10 SASI_Rn01_00146293 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044189 predicted 1551
2 SASI_Mm02_00344528 predicted 1255
3 SASI_Mm01_00044190 predicted 1311
4 SASI_Mm01_00044191 predicted 1242
5 SASI_Mm01_00044192 predicted 239
6 SASI_Mm01_00044193 predicted 1398
7 SASI_Mm01_00044194 predicted 1119
8 SASI_Mm01_00044195 predicted 1244
9 SASI_Mm01_00044196 predicted 636
10 SASI_Mm01_00044197 predicted 715
11 SASI_Mm01_00044198 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349623 predicted 2660
2 SASI_Mm01_00183156 predicted 1246
3 SASI_Mm01_00183157 predicted 1114
4 SASI_Mm02_00349624 predicted 2136
5 SASI_Mm01_00183158 predicted 1244
6 SASI_Mm01_00183159 predicted 639
7 SASI_Mm01_00183162 predicted 1596
8 SASI_Mm01_00183163 predicted 2656
9 SASI_Mm01_00183164 predicted 652
10 SASI_Mm02_00349625 predicted 1106
11 SASI_Mm01_00183155 predicted 1553
12 SASI_Mm01_00183160 predicted 2559
13 SASI_Mm01_00183161 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152743
VALIDATED
BRAT1 MISSION shRNA Bacterial Glycerol Stock
BRCA1-associated ATM activator 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-141s1c1
Sequence:CCGGGAAGCTCCTGGACTGGTTTAACTCGAGTTAAACCAGTCCAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2205s1c1
Sequence:CCGGGTCTTGTGACCTCCTTCTCTTCTCGAGAAGAGAAGGAGGTCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-340s1c1
Sequence:CCGGGAGTTACTACCAGGGCTCTTTCTCGAGAAAGAGCCCTGGTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-315s1c1
Sequence:CCGGCTGCTTCCAGTATCTTCAGCACTCGAGTGCTGAAGATACTGGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2221s1c1
Sequence:CCGGCTCTTCCTGAGGGACAAGATTCTCGAGAATCTTGTCCCTCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-2158s21c1
Sequence:CCGGTGTGCCTTGTTTGACTGCGACCTCGAGGTCGCAGTCAAACAAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1832s21c1
Sequence:CCGGTGCACATCCTCTCCGTAGACTCTCGAGAGTCTACGGAGAGGATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-633s21c1
Sequence:CCGGGATCATGGATCACGTTGAAGACTCGAGTCTTCAACGTGATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-231s21c1
Sequence:CCGGGAAAGTCCAGGACCTGAGTTCCTCGAGGAACTCAGGTCCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1647s21c1
Sequence:CCGGTGACTTCAGATGCGCACTCTTCTCGAGAAGAGTGCGCATCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152743
VALIDATED
BRAT1 MISSION shRNA shRNA Plasmid DNA
BRCA1-associated ATM activator 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-141s1c1
Sequence:CCGGGAAGCTCCTGGACTGGTTTAACTCGAGTTAAACCAGTCCAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2205s1c1
Sequence:CCGGGTCTTGTGACCTCCTTCTCTTCTCGAGAAGAGAAGGAGGTCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-340s1c1
Sequence:CCGGGAGTTACTACCAGGGCTCTTTCTCGAGAAAGAGCCCTGGTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-315s1c1
Sequence:CCGGCTGCTTCCAGTATCTTCAGCACTCGAGTGCTGAAGATACTGGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2221s1c1
Sequence:CCGGCTCTTCCTGAGGGACAAGATTCTCGAGAATCTTGTCCCTCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-2158s21c1
Sequence:CCGGTGTGCCTTGTTTGACTGCGACCTCGAGGTCGCAGTCAAACAAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1832s21c1
Sequence:CCGGTGCACATCCTCTCCGTAGACTCTCGAGAGTCTACGGAGAGGATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-633s21c1
Sequence:CCGGGATCATGGATCACGTTGAAGACTCGAGTCTTCAACGTGATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-231s21c1
Sequence:CCGGGAAAGTCCAGGACCTGAGTTCCTCGAGGAACTCAGGTCCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1647s21c1
Sequence:CCGGTGACTTCAGATGCGCACTCTTCTCGAGAAGAGTGCGCATCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152743
VALIDATED
BRAT1 MISSION shRNA Lentiviral Transduction Particles
BRCA1-associated ATM activator 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-141s1c1
Sequence:CCGGGAAGCTCCTGGACTGGTTTAACTCGAGTTAAACCAGTCCAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2205s1c1
Sequence:CCGGGTCTTGTGACCTCCTTCTCTTCTCGAGAAGAGAAGGAGGTCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-340s1c1
Sequence:CCGGGAGTTACTACCAGGGCTCTTTCTCGAGAAAGAGCCCTGGTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-315s1c1
Sequence:CCGGCTGCTTCCAGTATCTTCAGCACTCGAGTGCTGAAGATACTGGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152743.1-2221s1c1
Sequence:CCGGCTCTTCCTGAGGGACAAGATTCTCGAGAATCTTGTCCCTCAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-2158s21c1
Sequence:CCGGTGTGCCTTGTTTGACTGCGACCTCGAGGTCGCAGTCAAACAAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1832s21c1
Sequence:CCGGTGCACATCCTCTCCGTAGACTCTCGAGAGTCTACGGAGAGGATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-633s21c1
Sequence:CCGGGATCATGGATCACGTTGAAGACTCGAGTCTTCAACGTGATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-231s21c1
Sequence:CCGGGAAAGTCCAGGACCTGAGTTCCTCGAGGAACTCAGGTCCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152743.2-1647s21c1
Sequence:CCGGTGACTTCAGATGCGCACTCTTCTCGAGAAGAGTGCGCATCTGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172724
BRAT1 MISSION shRNA Bacterial Glycerol Stock
BRCA1-associated ATM activator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172724.3-3245s21c1
Sequence:CCGGCCTATGATCACAGCGTTTAAACTCGAGTTTAAACGCTGTGATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-217s21c1
Sequence:CCGGACAGGACCATCCCTGCTTAATCTCGAGATTAAGCAGGGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1243s21c1
Sequence:CCGGGCAAGCTGCTTTGACTATATTCTCGAGAATATAGTCAAAGCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-562s21c1
Sequence:CCGGCAGCCAGCTCCTAGTACATATCTCGAGATATGTACTAGGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1110s21c1
Sequence:CCGGGCTTGCTGACTGTGGATATACCTCGAGGTATATCCACAGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172724
BRAT1 MISSION shRNA shRNA Plasmid DNA
BRCA1-associated ATM activator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172724.3-3245s21c1
Sequence:CCGGCCTATGATCACAGCGTTTAAACTCGAGTTTAAACGCTGTGATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-217s21c1
Sequence:CCGGACAGGACCATCCCTGCTTAATCTCGAGATTAAGCAGGGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1243s21c1
Sequence:CCGGGCAAGCTGCTTTGACTATATTCTCGAGAATATAGTCAAAGCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-562s21c1
Sequence:CCGGCAGCCAGCTCCTAGTACATATCTCGAGATATGTACTAGGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1110s21c1
Sequence:CCGGGCTTGCTGACTGTGGATATACCTCGAGGTATATCCACAGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172724
BRAT1 MISSION shRNA Lentiviral Transduction Particles
BRCA1-associated ATM activator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172724.3-3245s21c1
Sequence:CCGGCCTATGATCACAGCGTTTAAACTCGAGTTTAAACGCTGTGATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-217s21c1
Sequence:CCGGACAGGACCATCCCTGCTTAATCTCGAGATTAAGCAGGGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1243s21c1
Sequence:CCGGGCAAGCTGCTTTGACTATATTCTCGAGAATATAGTCAAAGCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-562s21c1
Sequence:CCGGCAGCCAGCTCCTAGTACATATCTCGAGATATGTACTAGGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172724.3-1110s21c1
Sequence:CCGGGCTTGCTGACTGTGGATATACCTCGAGGTATATCCACAGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks