EMAIL THIS PAGE TO A FRIEND

BRCA1

breast cancer 1, early onset

282 Gene Product Result for
Synonyms: BRCAI BRCC1 BROVCA1 IRIS PNCA4 PPP1R53 PSCP RNF53
UniProtKB ID: P38398, O15129, Q3LRJ0, Q3LRJ6, Q6IN79, Q7KYU9
Gene ID:
Human(672) Summary: This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
Mouse(12189) breast cancer 1
Rat(497672) breast cancer 1, early onset
Thale Cress(827854) protein BREAST CANCER SUSCEPTIBILITY 1-like protein
domestic cat(493761) breast cancer 1, early onset
cow(353120) breast cancer 1, early onset
Horse(100051990) breast cancer 1, early onset
domestic cat(101081937) breast cancer 1, early onset
dog(403437) breast cancer 1, early onset
chicken(373983) breast cancer 1, early onset
naked mole-rat(101705460) breast cancer 1, early onset
domestic guinea pig(100722339) breast cancer 1, early onset
sheep(101108584) breast cancer 1, early onset
Domestic Rabbit(100347269) breast cancer 1, early onset
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300490 Anti-BRCA1 (Ab-1423) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300411 Anti-BRCA1 (Ab-1524) antibody produced in rabbit affinity isolated antibody human
immunofluorescence pricing
GW21183 Anti-BRCA1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV02017 Anti-BRCA1 antibody produced in rabbit affinity isolated antibody human, bovine, pig, canine
immunohistochemistry, western blot pricing
SAB2104043 Anti-BRCA1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA034966 Anti-BRCA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502848 Anti-BRCA1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunohistochemistry pricing
SAB4502849 Anti-BRCA1, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4300192 Anti-phospho-BRCA1 (pSer1423) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504354 Anti-phospho-BRCA1 (pSer1423) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4504693 Anti-phospho-BRCA1 (pSer1457) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301345 Anti-phospho-BRCA1 (pSer1457) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300096 Anti-phospho-BRCA1 (pSer1524) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504355 Anti-phospho-BRCA1 (pSer988) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB2702134 Monoclonal Anti-BRCA1 antibody produced in mouse mouse, human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB2702136 Monoclonal Anti-BRCA1 antibody produced in mouse mouse, human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
PLA0185 Rabbit anti-BRCA1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0003 Rabbit anti-Phospho BRCA1 (S1280) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, gibbon, rhesus monkey, marmoset, human
immunoprecipitation, proximity ligation assay, western blot pricing
PLA0002 Rabbit anti-Phospho BRCA1 (S1524) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, chimpanzee, human
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007294 Rosetta Predictions human pricing
NM_007295 Rosetta Predictions human pricing
NM_007296 Rosetta Predictions human pricing
NM_007297 Rosetta Predictions human pricing
NM_007298 Rosetta Predictions human pricing
NM_007299 Rosetta Predictions human pricing
NM_007300 Rosetta Predictions human pricing
NM_007302 Rosetta Predictions human pricing
NM_007303 Rosetta Predictions human pricing
NM_007304 Rosetta Predictions human pricing
NM_007305 Rosetta Predictions human pricing
NM_012514 Rosetta Predictions rat pricing
XM_579334 Rosetta Predictions rat pricing
NM_009764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179500 predicted 5884
2 SASI_Hs01_00179501 predicted 5651
3 SASI_Hs01_00179502 predicted 5945
4 SASI_Hs02_00343364 predicted 6046
5 SASI_Hs01_00179504 predicted 5670
6 SASI_Hs01_00179505 predicted 6064
7 SASI_Hs01_00179506 predicted 5880
8 SASI_Hs01_00179507 predicted 6110
9 SASI_Hs01_00179508 predicted 5679
10 SASI_Hs01_00179509 predicted 5657
11 SASI_Hs01_00179503 predicted 6069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057173 predicted 6087
2 SASI_Hs01_00057174 predicted 5841
3 SASI_Hs01_00057175 predicted 6135
4 SASI_Hs02_00343365 predicted 6238
5 SASI_Hs01_00057177 predicted 5865
6 SASI_Hs01_00057178 predicted 6261
7 SASI_Hs01_00057179 predicted 6077
8 SASI_Hs01_00057180 predicted 6308
9 SASI_Hs01_00057181 predicted 5879
10 SASI_Hs01_00057182 predicted 5857
11 SASI_Hs01_00057176 predicted 6272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205171 predicted 5877
2 SASI_Hs01_00205172 predicted 5643
3 SASI_Hs01_00205173 predicted 5935
4 SASI_Hs02_00343366 predicted 6039
5 SASI_Hs01_00205175 predicted 5660
6 SASI_Hs01_00205176 predicted 6055
7 SASI_Hs01_00205177 predicted 5875
8 SASI_Hs01_00205178 predicted 6105
9 SASI_Hs01_00205179 predicted 5676
10 SASI_Hs01_00205180 predicted 5652
11 SASI_Hs01_00205174 predicted 6062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150725 predicted 5192
2 SASI_Hs01_00150726 predicted 4960
3 SASI_Hs01_00150727 predicted 5248
4 SASI_Hs02_00343367 predicted 5352
5 SASI_Hs01_00150729 predicted 4981
6 SASI_Hs01_00150730 predicted 5379
7 SASI_Hs01_00150731 predicted 5189
8 SASI_Hs01_00150732 predicted 5418
9 SASI_Hs01_00150733 predicted 4998
10 SASI_Hs01_00150734 predicted 4972
11 SASI_Hs01_00150728 predicted 5387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019842 predicted 2340
2 SASI_Hs01_00019843 predicted 2100
3 SASI_Hs01_00019844 predicted 2390
4 SASI_Hs02_00343368 predicted 2492
5 SASI_Hs01_00019846 predicted 2120
6 SASI_Hs01_00019847 predicted 2515
7 SASI_Hs01_00019848 predicted 2330
8 SASI_Hs01_00019849 predicted 2561
9 SASI_Hs01_00019850 predicted 2133
10 SASI_Hs01_00019851 predicted 2106
11 SASI_Hs01_00019845 predicted 2523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079379 predicted 5172
2 SASI_Hs01_00079380 predicted 4932
3 SASI_Hs01_00079381 predicted 5225
4 SASI_Hs02_00343369 predicted 5330
5 SASI_Hs01_00079383 predicted 4949
6 SASI_Hs01_00079384 predicted 5347
7 SASI_Hs01_00079385 predicted 5161
8 SASI_Hs01_00079386 predicted 5398
9 SASI_Hs01_00079387 predicted 4971
10 SASI_Hs01_00079388 predicted 4938
11 SASI_Hs01_00079382 predicted 5359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149888 predicted 5086
2 SASI_Hs01_00149889 predicted 4851
3 SASI_Hs01_00149890 predicted 5148
4 SASI_Hs02_00343370 predicted 5250
5 SASI_Hs01_00149892 predicted 4870
6 SASI_Hs01_00149893 predicted 5266
7 SASI_Hs01_00149894 predicted 5089
8 SASI_Hs01_00149895 predicted 5311
9 SASI_Hs01_00149896 predicted 4888
10 SASI_Hs01_00149897 predicted 4863
11 SASI_Hs01_00149891 predicted 5283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103437 predicted 5767
2 SASI_Hs01_00103438 predicted 5524
3 SASI_Hs01_00103439 predicted 5813
4 SASI_Hs02_00343371 predicted 5919
5 SASI_Hs01_00103441 predicted 5544
6 SASI_Hs01_00103442 predicted 5940
7 SASI_Hs01_00103443 predicted 5763
8 SASI_Hs01_00103444 predicted 5991
9 SASI_Hs01_00103445 predicted 5562
10 SASI_Hs01_00103446 predicted 5536
11 SASI_Hs01_00103440 predicted 5955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124497 predicted 2459
2 SASI_Hs01_00124498 predicted 2218
3 SASI_Hs01_00124499 predicted 2513
4 SASI_Hs02_00343372 predicted 2616
5 SASI_Hs01_00124501 predicted 2246
6 SASI_Hs01_00124502 predicted 2634
7 SASI_Hs01_00124503 predicted 2455
8 SASI_Hs01_00124504 predicted 2686
9 SASI_Hs01_00124505 predicted 2258
10 SASI_Hs01_00124506 predicted 2228
11 SASI_Hs01_00124500 predicted 2646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125404 predicted 2575
2 SASI_Hs01_00125405 predicted 2339
3 SASI_Hs01_00125406 predicted 2632
4 SASI_Hs02_00343373 predicted 2734
5 SASI_Hs01_00125408 predicted 2360
6 SASI_Hs01_00125409 predicted 2754
7 SASI_Hs01_00125410 predicted 2568
8 SASI_Hs01_00125411 predicted 2797
9 SASI_Hs01_00125412 predicted 2375
10 SASI_Hs01_00125413 predicted 2344
11 SASI_Hs01_00125407 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195003 predicted 2454
2 SASI_Hs01_00195004 predicted 2214
3 SASI_Hs01_00195005 predicted 2512
4 SASI_Hs02_00343374 predicted 2614
5 SASI_Hs01_00195007 predicted 2237
6 SASI_Hs01_00195008 predicted 2637
7 SASI_Hs01_00195009 predicted 2453
8 SASI_Hs01_00195010 predicted 2679
9 SASI_Hs01_00195011 predicted 2253
10 SASI_Hs01_00195012 predicted 2222
11 SASI_Hs01_00195006 predicted 2646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259574 predicted 1242
2 SASI_Rn01_00113382 predicted 1657
3 SASI_Rn01_00113383 predicted 5083
4 SASI_Rn01_00113384 predicted 3409
5 SASI_Rn02_00259575 predicted 302
6 SASI_Rn01_00113385 predicted 645
7 SASI_Rn01_00113386 predicted 344
8 SASI_Rn01_00113387 predicted 1536
9 SASI_Rn01_00113388 predicted 1069
10 SASI_Rn02_00259576 predicted 4973
11 SASI_Rn01_00113389 predicted 2771
12 SASI_Rn01_00113390 predicted 1019
13 SASI_Rn01_00113391 predicted 5097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169458 predicted 2789
2 SASI_Rn01_00169459 predicted 2589
3 SASI_Rn01_00169460 predicted 2555
4 SASI_Rn01_00169461 predicted 2664
5 SASI_Rn01_00169462 predicted 2766
6 SASI_Rn01_00169463 predicted 5357
7 SASI_Rn01_00169464 predicted 5186
8 SASI_Rn01_00169465 predicted 2654
9 SASI_Rn01_00169466 predicted 2854
10 SASI_Rn01_00169467 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063488 predicted 5054
2 SASI_Mm01_00063489 predicted 772
3 SASI_Mm01_00063490 predicted 1624
4 SASI_Mm02_00316960 predicted 307
5 SASI_Mm01_00063491 predicted 5161
6 SASI_Mm01_00063492 predicted 1427
7 SASI_Mm01_00063493 predicted 5080
8 SASI_Mm01_00063494 predicted 2196
9 SASI_Mm01_00063495 predicted 2949
10 SASI_Mm01_00063497 predicted 4691
11 SASI_Mm01_00063496 predicted 2509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009764
VALIDATED
BRCA1 MISSION shRNA Bacterial Glycerol Stock
breast cancer 1, early onset
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-4157s21c1
Sequence:CCGGCCAAGAAGAGGATAGTATAATCTCGAGATTATACTATCCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-390s21c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-3055s21c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-2577s21c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009764.3-5692s21c1
Sequence:CCGGGTGCTTCCACACCCTACTTACCTCGAGGTAAGTAGGGTGTGGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009764.2-4874s1c1
Sequence:CCGGCCTCACTTTAACTGACGCAATCTCGAGATTGCGTCAGTTAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2397s1c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2875s1c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-210s1c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-1324s1c1
Sequence:CCGGCCCATCATACTTTAATGTGTACTCGAGTACACATTAAAGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009764
VALIDATED
BRCA1 MISSION shRNA shRNA Plasmid DNA
breast cancer 1, early onset
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-4157s21c1
Sequence:CCGGCCAAGAAGAGGATAGTATAATCTCGAGATTATACTATCCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-390s21c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-3055s21c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-2577s21c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009764.3-5692s21c1
Sequence:CCGGGTGCTTCCACACCCTACTTACCTCGAGGTAAGTAGGGTGTGGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009764.2-4874s1c1
Sequence:CCGGCCTCACTTTAACTGACGCAATCTCGAGATTGCGTCAGTTAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2397s1c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2875s1c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-210s1c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-1324s1c1
Sequence:CCGGCCCATCATACTTTAATGTGTACTCGAGTACACATTAAAGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009764
VALIDATED
BRCA1 MISSION shRNA Lentiviral Transduction Particles
breast cancer 1, early onset
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-4157s21c1
Sequence:CCGGCCAAGAAGAGGATAGTATAATCTCGAGATTATACTATCCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-390s21c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-3055s21c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009764.3-2577s21c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009764.3-5692s21c1
Sequence:CCGGGTGCTTCCACACCCTACTTACCTCGAGGTAAGTAGGGTGTGGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009764.2-4874s1c1
Sequence:CCGGCCTCACTTTAACTGACGCAATCTCGAGATTGCGTCAGTTAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2397s1c1
Sequence:CCGGGCTCAGTGTATGACTCAGTTTCTCGAGAAACTGAGTCATACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-2875s1c1
Sequence:CCGGCCACAGGTAAATCAGGAATTTCTCGAGAAATTCCTGATTTACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-210s1c1
Sequence:CCGGCCTTTGTGTAAGAATGAGATACTCGAGTATCTCATTCTTACACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009764.2-1324s1c1
Sequence:CCGGCCCATCATACTTTAATGTGTACTCGAGTACACATTAAAGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007294
VALIDATED
BRCA1 MISSION shRNA Bacterial Glycerol Stock
breast cancer 1, early onset
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5058s21c1
Sequence:CCGGACTGATACTGCTGGGTATAATCTCGAGATTATACCCAGCAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-3465s21c1
Sequence:CCGGTTGCAACCTGAGGTCTATAAACTCGAGTTTATAGACCTCAGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-1976s21c1
Sequence:CCGGCAATATGGAACTCGAATTAAACTCGAGTTTAATTCGAGTTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-498s21c1
Sequence:CCGGGAGTATGCAAACAGCTATAATCTCGAGATTATAGCTGTTTGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5945s21c1
Sequence:CCGGGCTATGCAAGGGTCCCTTAAACTCGAGTTTAAGGGACCCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-1481s1c1
Sequence:CCGGAGAATCCTAGAGATACTGAACTCGAGTTCAGTATCTCTAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-7048s1c1
Sequence:CCGGTATAAGACCTCTGGCATGAATCTCGAGATTCATGCCAGAGGTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007294.x-7237s1c1
Sequence:CCGGTATAGCTGTTGGAAGGACTAGCTCGAGCTAGTCCTTCCAACAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-4632s1c1
Sequence:CCGGCCCTTCTAAATGCCCATCATTCTCGAGAATGATGGGCATTTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-6116s1c1
Sequence:CCGGCCCTAAGTTTACTTCTCTAAACTCGAGTTTAGAGAAGTAAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-2037s1c1
Sequence:CCGGCCCACCTAATTGTACTGAATTCTCGAGAATTCAGTACAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-2036s1c1
Sequence:CCGGGCCCACCTAATTGTACTGAATCTCGAGATTCAGTACAATTAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-356s1c1
Sequence:CCGGGCCTACAAGAAAGTACGAGATCTCGAGATCTCGTACTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007294
VALIDATED
BRCA1 MISSION shRNA shRNA Plasmid DNA
breast cancer 1, early onset
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5058s21c1
Sequence:CCGGACTGATACTGCTGGGTATAATCTCGAGATTATACCCAGCAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-3465s21c1
Sequence:CCGGTTGCAACCTGAGGTCTATAAACTCGAGTTTATAGACCTCAGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-1976s21c1
Sequence:CCGGCAATATGGAACTCGAATTAAACTCGAGTTTAATTCGAGTTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-498s21c1
Sequence:CCGGGAGTATGCAAACAGCTATAATCTCGAGATTATAGCTGTTTGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5945s21c1
Sequence:CCGGGCTATGCAAGGGTCCCTTAAACTCGAGTTTAAGGGACCCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-1481s1c1
Sequence:CCGGAGAATCCTAGAGATACTGAACTCGAGTTCAGTATCTCTAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-7048s1c1
Sequence:CCGGTATAAGACCTCTGGCATGAATCTCGAGATTCATGCCAGAGGTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007294.x-7237s1c1
Sequence:CCGGTATAGCTGTTGGAAGGACTAGCTCGAGCTAGTCCTTCCAACAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-4632s1c1
Sequence:CCGGCCCTTCTAAATGCCCATCATTCTCGAGAATGATGGGCATTTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-6116s1c1
Sequence:CCGGCCCTAAGTTTACTTCTCTAAACTCGAGTTTAGAGAAGTAAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-2037s1c1
Sequence:CCGGCCCACCTAATTGTACTGAATTCTCGAGAATTCAGTACAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-2036s1c1
Sequence:CCGGGCCCACCTAATTGTACTGAATCTCGAGATTCAGTACAATTAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-356s1c1
Sequence:CCGGGCCTACAAGAAAGTACGAGATCTCGAGATCTCGTACTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007294
VALIDATED
BRCA1 MISSION shRNA Lentiviral Transduction Particles
breast cancer 1, early onset
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5058s21c1
Sequence:CCGGACTGATACTGCTGGGTATAATCTCGAGATTATACCCAGCAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-3465s21c1
Sequence:CCGGTTGCAACCTGAGGTCTATAAACTCGAGTTTATAGACCTCAGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-1976s21c1
Sequence:CCGGCAATATGGAACTCGAATTAAACTCGAGTTTAATTCGAGTTCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-498s21c1
Sequence:CCGGGAGTATGCAAACAGCTATAATCTCGAGATTATAGCTGTTTGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007294.2-5945s21c1
Sequence:CCGGGCTATGCAAGGGTCCCTTAAACTCGAGTTTAAGGGACCCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-1481s1c1
Sequence:CCGGAGAATCCTAGAGATACTGAACTCGAGTTCAGTATCTCTAGGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.x-7048s1c1
Sequence:CCGGTATAAGACCTCTGGCATGAATCTCGAGATTCATGCCAGAGGTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007294.x-7237s1c1
Sequence:CCGGTATAGCTGTTGGAAGGACTAGCTCGAGCTAGTCCTTCCAACAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-4632s1c1
Sequence:CCGGCCCTTCTAAATGCCCATCATTCTCGAGAATGATGGGCATTTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-6116s1c1
Sequence:CCGGCCCTAAGTTTACTTCTCTAAACTCGAGTTTAGAGAAGTAAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007294.1-2037s1c1
Sequence:CCGGCCCACCTAATTGTACTGAATTCTCGAGAATTCAGTACAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-2036s1c1
Sequence:CCGGGCCCACCTAATTGTACTGAATCTCGAGATTCAGTACAATTAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007294.1-356s1c1
Sequence:CCGGGCCTACAAGAAAGTACGAGATCTCGAGATCTCGTACTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks