EMAIL THIS PAGE TO A FRIEND

BRCA2

breast cancer 2, early onset

78 Gene Product Result for
Synonyms: BRCC2 BROVCA2 FACD FAD FAD1 FANCB FANCD FANCD1 GLM3 PNCA2
UniProtKB ID: P51587, O00183, O15008, Q13879, Q5TBJ7
Gene ID:
Human(675) Summary: Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
Mouse(12190) breast cancer 2
Rat(360254) breast cancer 2, early onset
Zebrafish(566758) breast cancer 2, early onset
fruit fly(37916) Breast cancer 2, early onset homolog
cow(507069) breast cancer 2, early onset
Horse(100064578) breast cancer 2, early onset
domestic cat(493878) breast cancer 2, early onset
dog(474180) breast cancer 2, early onset
chicken(374139) breast cancer 2, early onset
sheep(101109980) breast cancer 2, early onset
domestic guinea pig(100713136) breast cancer 2, early onset
naked mole-rat(101698015) breast cancer 2, early onset
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000059 Rosetta Predictions human pricing
NM_031542 Rosetta Predictions rat pricing
NM_001081001 Rosetta Predictions mouse pricing
NM_009765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121791 predicted 7207
2 SASI_Hs01_00121792 predicted 1189
3 SASI_Hs01_00121794 predicted 7838
4 SASI_Hs01_00121795 predicted 7219
5 SASI_Hs01_00121796 predicted 7689
6 SASI_Hs02_00301773 predicted 6725
7 SASI_Hs02_00301774 predicted 9618
8 SASI_Hs02_00301775 predicted 6680
9 SASI_Hs01_00121798 predicted 8729
10 SASI_Hs01_00121799 predicted 8084
11 SASI_Hs01_00121793 predicted 1556
12 SASI_Hs01_00121797 predicted 4709
13 SASI_Hs01_00121800 predicted 5471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036050 predicted 3230
2 SASI_Rn02_00264712 predicted 4155
3 SASI_Rn01_00036051 predicted 3042
4 SASI_Rn01_00036052 predicted 7575
5 SASI_Rn01_00036053 predicted 2402
6 SASI_Rn02_00264713 predicted 5331
7 SASI_Rn01_00036054 predicted 7827
8 SASI_Rn01_00036055 predicted 8468
9 SASI_Rn01_00036056 predicted 4680
10 SASI_Rn02_00264714 predicted 3289
11 SASI_Rn01_00036057 predicted 5566
12 SASI_Rn01_00036058 predicted 252
13 SASI_Rn01_00036059 predicted 8985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294286 predicted 4861
2 SASI_Mm02_00294287 predicted 3608
3 SASI_Mm02_00294288 predicted 3114
4 SASI_Mm02_00294289 predicted 9238
5 SASI_Mm02_00294290 predicted 5638
6 SASI_Mm02_00294291 predicted 3354
7 SASI_Mm02_00294292 predicted 1957
8 SASI_Mm02_00294293 predicted 3264
9 SASI_Mm02_00294294 predicted 8361
10 SASI_Mm02_00294295 predicted 4643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316961 predicted 4668
2 SASI_Mm01_00022573 predicted 3414
3 SASI_Mm01_00022574 predicted 2931
4 SASI_Mm02_00316962 predicted 9042
5 SASI_Mm01_00022576 predicted 5459
6 SASI_Mm01_00022577 predicted 3166
7 SASI_Mm01_00022578 predicted 1772
8 SASI_Mm01_00022579 predicted 3081
9 SASI_Mm01_00022580 predicted 8170
10 SASI_Mm01_00022581 predicted 4460
11 SASI_Mm01_00022572 predicted 1996
12 SASI_Mm01_00022575 predicted 7416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000059
VALIDATED
BRCA2 MISSION shRNA Bacterial Glycerol Stock
breast cancer 2, early onset
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000059.1-10516s1c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-5701s1c1
Sequence:CCGGGCAGCCATTAAATTGTCCATACTCGAGTATGGACAATTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-9010s1c1
Sequence:CCGGGCCTTGAATAATCACAGGCAACTCGAGTTGCCTGTGATTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-10567s1c1
Sequence:CCGGTAGTACTTATGTTGCACAATGCTCGAGCATTGTGCAACATAAGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-665s1c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-1419s21c1
Sequence:CCGGCTAACCCTTTCAGGTCTAAATCTCGAGATTTAGACCTGAAAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000059.3-10515s21c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7858s21c1
Sequence:CCGGGCGTTTCTAAACATTGCATAACTCGAGTTATGCAATGTTTAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7694s21c1
Sequence:CCGGTATACAGGATATGCGAATTAACTCGAGTTAATTCGCATATCCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-8969s21c1
Sequence:CCGGAGCTTACCTTGAGGGTTATTTCTCGAGAAATAACCCTCAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-664s21c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000059
VALIDATED
BRCA2 MISSION shRNA shRNA Plasmid DNA
breast cancer 2, early onset
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000059.1-10516s1c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-5701s1c1
Sequence:CCGGGCAGCCATTAAATTGTCCATACTCGAGTATGGACAATTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-9010s1c1
Sequence:CCGGGCCTTGAATAATCACAGGCAACTCGAGTTGCCTGTGATTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-10567s1c1
Sequence:CCGGTAGTACTTATGTTGCACAATGCTCGAGCATTGTGCAACATAAGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-665s1c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-1419s21c1
Sequence:CCGGCTAACCCTTTCAGGTCTAAATCTCGAGATTTAGACCTGAAAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000059.3-10515s21c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7858s21c1
Sequence:CCGGGCGTTTCTAAACATTGCATAACTCGAGTTATGCAATGTTTAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7694s21c1
Sequence:CCGGTATACAGGATATGCGAATTAACTCGAGTTAATTCGCATATCCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-8969s21c1
Sequence:CCGGAGCTTACCTTGAGGGTTATTTCTCGAGAAATAACCCTCAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-664s21c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000059
VALIDATED
BRCA2 MISSION shRNA Lentiviral Transduction Particles
breast cancer 2, early onset
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000059.1-10516s1c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-5701s1c1
Sequence:CCGGGCAGCCATTAAATTGTCCATACTCGAGTATGGACAATTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000059.1-9010s1c1
Sequence:CCGGGCCTTGAATAATCACAGGCAACTCGAGTTGCCTGTGATTATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-10567s1c1
Sequence:CCGGTAGTACTTATGTTGCACAATGCTCGAGCATTGTGCAACATAAGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000059.x-665s1c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-1419s21c1
Sequence:CCGGCTAACCCTTTCAGGTCTAAATCTCGAGATTTAGACCTGAAAGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000059.3-10515s21c1
Sequence:CCGGCGCTTAACCTTTCCAGTTTATCTCGAGATAAACTGGAAAGGTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7858s21c1
Sequence:CCGGGCGTTTCTAAACATTGCATAACTCGAGTTATGCAATGTTTAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-7694s21c1
Sequence:CCGGTATACAGGATATGCGAATTAACTCGAGTTAATTCGCATATCCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-8969s21c1
Sequence:CCGGAGCTTACCTTGAGGGTTATTTCTCGAGAAATAACCCTCAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000059.3-664s21c1
Sequence:CCGGTACAATGTACACATGTAACACCTCGAGGTGTTACATGTGTACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009765
VALIDATED
BRCA2 MISSION shRNA Bacterial Glycerol Stock
breast cancer 2, early onset
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8714s1c1
Sequence:CCGGGCGGGTTACAAGCTACAAGAACTCGAGTTCTTGTAGCTTGTAACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-2586s1c1
Sequence:CCGGGCAGTCAATATGAACTCTGAACTCGAGTTCAGAGTTCATATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-7430s1c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-757s1c1
Sequence:CCGGCCTCAGTGATTGACAGTGAAACTCGAGTTTCACTGTCAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8583s1c1
Sequence:CCGGGCCTTGAACAACTACAGACAACTCGAGTTGTCTGTAGTTGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-9984s21c1
Sequence:CCGGACGGAGCTGTGGCACGAAATACTCGAGTATTTCGTGCCACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7412s21c1
Sequence:CCGGTCAATAGCAAGAACGTTAATTCTCGAGAATTAACGTTCTTGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7704s21c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009765.2-10325s21c1
Sequence:CCGGACAGTTCCAGGCTACTCATAGCTCGAGCTATGAGTAGCCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-1776s21c1
Sequence:CCGGGAGTATCAGGAAGTCTATATTCTCGAGAATATAGACTTCCTGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009765
VALIDATED
BRCA2 MISSION shRNA shRNA Plasmid DNA
breast cancer 2, early onset
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8714s1c1
Sequence:CCGGGCGGGTTACAAGCTACAAGAACTCGAGTTCTTGTAGCTTGTAACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-2586s1c1
Sequence:CCGGGCAGTCAATATGAACTCTGAACTCGAGTTCAGAGTTCATATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-7430s1c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-757s1c1
Sequence:CCGGCCTCAGTGATTGACAGTGAAACTCGAGTTTCACTGTCAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8583s1c1
Sequence:CCGGGCCTTGAACAACTACAGACAACTCGAGTTGTCTGTAGTTGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-9984s21c1
Sequence:CCGGACGGAGCTGTGGCACGAAATACTCGAGTATTTCGTGCCACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7412s21c1
Sequence:CCGGTCAATAGCAAGAACGTTAATTCTCGAGAATTAACGTTCTTGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7704s21c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009765.2-10325s21c1
Sequence:CCGGACAGTTCCAGGCTACTCATAGCTCGAGCTATGAGTAGCCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-1776s21c1
Sequence:CCGGGAGTATCAGGAAGTCTATATTCTCGAGAATATAGACTTCCTGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009765
VALIDATED
BRCA2 MISSION shRNA Lentiviral Transduction Particles
breast cancer 2, early onset
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8714s1c1
Sequence:CCGGGCGGGTTACAAGCTACAAGAACTCGAGTTCTTGTAGCTTGTAACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-2586s1c1
Sequence:CCGGGCAGTCAATATGAACTCTGAACTCGAGTTCAGAGTTCATATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-7430s1c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009765.1-757s1c1
Sequence:CCGGCCTCAGTGATTGACAGTGAAACTCGAGTTTCACTGTCAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009765.1-8583s1c1
Sequence:CCGGGCCTTGAACAACTACAGACAACTCGAGTTGTCTGTAGTTGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-9984s21c1
Sequence:CCGGACGGAGCTGTGGCACGAAATACTCGAGTATTTCGTGCCACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7412s21c1
Sequence:CCGGTCAATAGCAAGAACGTTAATTCTCGAGAATTAACGTTCTTGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-7704s21c1
Sequence:CCGGCGGCGTTTCTAAAGAGTGCATCTCGAGATGCACTCTTTAGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009765.2-10325s21c1
Sequence:CCGGACAGTTCCAGGCTACTCATAGCTCGAGCTATGAGTAGCCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009765.2-1776s21c1
Sequence:CCGGGAGTATCAGGAAGTCTATATTCTCGAGAATATAGACTTCCTGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks