EMAIL THIS PAGE TO A FRIEND

BRCC3

BRCA1/BRCA2-containing complex, subunit 3

122 Gene Product Result for
Synonyms: BRCC36 C6.1A CXorf53
Gene ID:
Human(79184) Summary: This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
Mouse(210766) BRCA1/BRCA2-containing complex, subunit 3
Rat(316794) BRCA1/BRCA2-containing complex, subunit 3
chicken(422201) BRCA1/BRCA2-containing complex, subunit 3
cow(519513) BRCA1/BRCA2-containing complex, subunit 3
Horse(100062237) BRCA1/BRCA2-containing complex, subunit 3
domestic cat(101096553) BRCA1/BRCA2-containing complex, subunit 3
dog(612642) BRCA1/BRCA2-containing complex, subunit 3
naked mole-rat(101719523) BRCA1/BRCA2-containing complex, subunit 3
domestic guinea pig(100719736) BRCA1/BRCA2-containing complex, subunit 3
sheep(101114756) BRCA1/BRCA2-containing complex, subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024332 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069041 MISSION® esiRNA esiRNA human BRCC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018055 Rosetta Predictions human pricing
NM_024332 Rosetta Predictions human pricing
NM_001127300 Rosetta Predictions rat pricing
NM_145956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177040 predicted 294
2 SASI_Hs01_00177042 predicted 322
3 SASI_Hs01_00177043 predicted 233
4 SASI_Hs01_00177044 predicted 343
5 SASI_Hs01_00177046 predicted 351
6 SASI_Hs01_00177047 predicted 230
7 SASI_Hs01_00177049 predicted 239
8 SASI_Hs02_00306941 predicted 224
9 SASI_Hs02_00306942 predicted 346
10 SASI_Hs02_00306943 predicted 296
11 SASI_Hs01_00177041 predicted 403
12 SASI_Hs01_00177045 predicted 308
13 SASI_Hs01_00177048 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356685 predicted 313
2 SASI_Hs01_00193368 predicted 296
3 SASI_Hs01_00193370 predicted 322
4 SASI_Hs01_00193371 predicted 226
5 SASI_Hs01_00193372 predicted 342
6 SASI_Hs01_00193374 predicted 352
7 SASI_Hs01_00193375 predicted 237
8 SASI_Hs01_00193376 predicted 406
9 SASI_Hs01_00193377 predicted 237
10 SASI_Hs02_00356686 predicted 206
11 SASI_Hs01_00193369 predicted 399
12 SASI_Hs01_00193373 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253563 predicted 670
2 SASI_Rn02_00253564 predicted 193
3 SASI_Rn02_00253565 predicted 1168
4 SASI_Rn02_00253566 predicted 317
5 SASI_Rn02_00253567 predicted 398
6 SASI_Rn02_00253568 predicted 405
7 SASI_Rn02_00253569 predicted 553
8 SASI_Rn02_00253570 predicted 421
9 SASI_Rn02_00253571 predicted 367
10 SASI_Rn02_00253572 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155757 predicted 498
2 SASI_Mm01_00155758 predicted 724
3 SASI_Mm01_00155759 predicted 275
4 SASI_Mm01_00155760 predicted 598
5 SASI_Mm01_00155761 predicted 328
6 SASI_Mm01_00155762 predicted 355
7 SASI_Mm01_00155763 predicted 602
8 SASI_Mm02_00341423 predicted 267
9 SASI_Mm01_00155764 predicted 363
10 SASI_Mm02_00341424 predicted 362
11 SASI_Mm01_00155765 predicted 573
12 SASI_Mm01_00155766 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145956
VALIDATED
BRCC3 MISSION shRNA Bacterial Glycerol Stock
BRCA1/BRCA2-containing complex, subunit 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-738s21c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145956.3-1271s21c1
Sequence:CCGGTTTCAGGAGTTAAGTACTTAACTCGAGTTAAGTACTTAACTCCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145956.3-139s21c1
Sequence:CCGGGGAGTTGAATGATGACATAAGCTCGAGCTTATGTCATCATTCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-517s21c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-387s21c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-389s1c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-604s1c1
Sequence:CCGGCCTCATATCACTATTGGGAAACTCGAGTTTCCCAATAGTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145956.2-519s1c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-331s1c1
Sequence:CCGGGCAGAAAGGTTGGCTGAACTACTCGAGTAGTTCAGCCAACCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-740s1c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145956
VALIDATED
BRCC3 MISSION shRNA shRNA Plasmid DNA
BRCA1/BRCA2-containing complex, subunit 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-738s21c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145956.3-1271s21c1
Sequence:CCGGTTTCAGGAGTTAAGTACTTAACTCGAGTTAAGTACTTAACTCCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145956.3-139s21c1
Sequence:CCGGGGAGTTGAATGATGACATAAGCTCGAGCTTATGTCATCATTCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-517s21c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-387s21c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-389s1c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-604s1c1
Sequence:CCGGCCTCATATCACTATTGGGAAACTCGAGTTTCCCAATAGTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145956.2-519s1c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-331s1c1
Sequence:CCGGGCAGAAAGGTTGGCTGAACTACTCGAGTAGTTCAGCCAACCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-740s1c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145956
VALIDATED
BRCC3 MISSION shRNA Lentiviral Transduction Particles
BRCA1/BRCA2-containing complex, subunit 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-738s21c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145956.3-1271s21c1
Sequence:CCGGTTTCAGGAGTTAAGTACTTAACTCGAGTTAAGTACTTAACTCCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145956.3-139s21c1
Sequence:CCGGGGAGTTGAATGATGACATAAGCTCGAGCTTATGTCATCATTCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-517s21c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145956.3-387s21c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-389s1c1
Sequence:CCGGCCCACCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-604s1c1
Sequence:CCGGCCTCATATCACTATTGGGAAACTCGAGTTTCCCAATAGTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145956.2-519s1c1
Sequence:CCGGCCGGGTACTCTATACTTGCTTCTCGAGAAGCAAGTATAGAGTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-331s1c1
Sequence:CCGGGCAGAAAGGTTGGCTGAACTACTCGAGTAGTTCAGCCAACCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145956.2-740s1c1
Sequence:CCGGGCTCAGTATTTACCAAGAATTCTCGAGAATTCTTGGTAAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024332
VALIDATED
BRCC3 MISSION shRNA Bacterial Glycerol Stock
BRCA1/BRCA2-containing complex, subunit 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-884s1c1
Sequence:CCGGCCAACAGCATTTGCAGGAATTCTCGAGAATTCCTGCAAATGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-645s1c1
Sequence:CCGGCCAATCCATATTGTACCTCATCTCGAGATGAGGTACAATATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-204s1c1
Sequence:CCGGGCCGTCAGAATTGTTCACATTCTCGAGAATGTGAACAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-370s1c1
Sequence:CCGGCCCATCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-85s1c1
Sequence:CCGGGCACAGAGAAGGAGGAAGTAACTCGAGTTACTTCCTCCTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024332
VALIDATED
BRCC3 MISSION shRNA shRNA Plasmid DNA
BRCA1/BRCA2-containing complex, subunit 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-884s1c1
Sequence:CCGGCCAACAGCATTTGCAGGAATTCTCGAGAATTCCTGCAAATGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-645s1c1
Sequence:CCGGCCAATCCATATTGTACCTCATCTCGAGATGAGGTACAATATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-204s1c1
Sequence:CCGGGCCGTCAGAATTGTTCACATTCTCGAGAATGTGAACAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-370s1c1
Sequence:CCGGCCCATCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-85s1c1
Sequence:CCGGGCACAGAGAAGGAGGAAGTAACTCGAGTTACTTCCTCCTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024332
VALIDATED
BRCC3 MISSION shRNA Lentiviral Transduction Particles
BRCA1/BRCA2-containing complex, subunit 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-884s1c1
Sequence:CCGGCCAACAGCATTTGCAGGAATTCTCGAGAATTCCTGCAAATGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-645s1c1
Sequence:CCGGCCAATCCATATTGTACCTCATCTCGAGATGAGGTACAATATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-204s1c1
Sequence:CCGGGCCGTCAGAATTGTTCACATTCTCGAGAATGTGAACAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-370s1c1
Sequence:CCGGCCCATCCTCATATAACTGTTTCTCGAGAAACAGTTATATGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024332.1-85s1c1
Sequence:CCGGGCACAGAGAAGGAGGAAGTAACTCGAGTTACTTCCTCCTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks