EMAIL THIS PAGE TO A FRIEND

BRD1

bromodomain containing 1

187 Gene Product Result for
Synonyms: BRL BRPF1 BRPF2
UniProtKB ID: O95696, A6ZJA4
Gene ID:
Human(23774) Summary: This gene encodes a protein of unknown function. The protein contains a bromodomain, a sequence motif often found in transcriptional coactivators, and localizes to the nucleus in testis and several other cell types. [provided by RefSeq, Jul 2008]
Mouse(223770) bromodomain containing 1
Rat(315210) bromodomain containing 1
chicken(417731) bromodomain containing 1
domestic cat(101098311) bromodomain containing 1
cow(100336626) bromodomain containing 1
Horse(100050039) bromodomain containing 1
dog(481198) bromodomain containing 1
domestic guinea pig(100722855) bromodomain containing 1
naked mole-rat(101716821) bromodomain containing 1
sheep(101121337) bromodomain containing 1
Domestic Rabbit(100346599) bromodomain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014577 Rosetta Predictions human pricing
NM_001108103 Rosetta Predictions rat pricing
NM_001033274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129646 predicted 2278
2 SASI_Hs01_00129647 predicted 3519
3 SASI_Hs01_00129648 predicted 2308
4 SASI_Hs02_00345851 predicted 3514
5 SASI_Hs01_00129652 predicted 1454
6 SASI_Hs01_00129653 predicted 1457
7 SASI_Hs01_00129654 predicted 3508
8 SASI_Hs01_00129655 predicted 1775
9 SASI_Hs02_00345852 predicted 584
10 SASI_Hs02_00345853 predicted 2328
11 SASI_Hs01_00129649 predicted 3553
12 SASI_Hs01_00129650 predicted 1758
13 SASI_Hs01_00129651 predicted 3751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235384 predicted 1844
2 SASI_Rn02_00235385 predicted 526
3 SASI_Rn02_00235386 predicted 1839
4 SASI_Rn02_00235387 predicted 533
5 SASI_Rn02_00235388 predicted 620
6 SASI_Rn02_00235389 predicted 1797
7 SASI_Rn02_00235390 predicted 597
8 SASI_Rn02_00235391 predicted 871
9 SASI_Rn02_00235392 predicted 1872
10 SASI_Rn02_00235393 predicted 2788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288461 predicted 3862
2 SASI_Mm02_00288462 predicted 2091
3 SASI_Mm02_00288463 predicted 2792
4 SASI_Mm02_00288464 predicted 1120
5 SASI_Mm02_00288465 predicted 1222
6 SASI_Mm02_00288466 predicted 523
7 SASI_Mm02_00288467 predicted 2717
8 SASI_Mm02_00288468 predicted 2122
9 SASI_Mm02_00288469 predicted 1273
10 SASI_Mm02_00288470 predicted 3101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014577
VALIDATED
BRD1 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3084s1c1
Sequence:CCGGCGAGCTTTAATGCGCCCAAATCTCGAGATTTGGGCGCATTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-2315s1c1
Sequence:CCGGGCCACAATGAGGAAACGGTTACTCGAGTAACCGTTTCCTCATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3421s1c1
Sequence:CCGGGCAGACCAAGTCTGATGAGAACTCGAGTTCTCATCAGACTTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-1846s1c1
Sequence:CCGGCCCGCAGAGGTTAAATAGGATCTCGAGATCCTATTTAACCTCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-3510s1c1
Sequence:CCGGCCCTTGGTATTGACGAAACTACTCGAGTAGTTTCGTCAATACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-626s21c1
Sequence:CCGGCGCTTGCACAGGATCAGTATTCTCGAGAATACTGATCCTGTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-1822s21c1
Sequence:CCGGGACCGTGTGCGCTCCTTATATCTCGAGATATAAGGAGCGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-3523s21c1
Sequence:CCGGCGAAACTATAGACAAGTTAAACTCGAGTTTAACTTGTCTATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-4208s21c1
Sequence:CCGGTGTGCCTCCCAGCGGATTATTCTCGAGAATAATCCGCTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-2333s21c1
Sequence:CCGGTTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014577
VALIDATED
BRD1 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3084s1c1
Sequence:CCGGCGAGCTTTAATGCGCCCAAATCTCGAGATTTGGGCGCATTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-2315s1c1
Sequence:CCGGGCCACAATGAGGAAACGGTTACTCGAGTAACCGTTTCCTCATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3421s1c1
Sequence:CCGGGCAGACCAAGTCTGATGAGAACTCGAGTTCTCATCAGACTTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-1846s1c1
Sequence:CCGGCCCGCAGAGGTTAAATAGGATCTCGAGATCCTATTTAACCTCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-3510s1c1
Sequence:CCGGCCCTTGGTATTGACGAAACTACTCGAGTAGTTTCGTCAATACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-626s21c1
Sequence:CCGGCGCTTGCACAGGATCAGTATTCTCGAGAATACTGATCCTGTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-1822s21c1
Sequence:CCGGGACCGTGTGCGCTCCTTATATCTCGAGATATAAGGAGCGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-3523s21c1
Sequence:CCGGCGAAACTATAGACAAGTTAAACTCGAGTTTAACTTGTCTATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-4208s21c1
Sequence:CCGGTGTGCCTCCCAGCGGATTATTCTCGAGAATAATCCGCTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-2333s21c1
Sequence:CCGGTTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014577
VALIDATED
BRD1 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3084s1c1
Sequence:CCGGCGAGCTTTAATGCGCCCAAATCTCGAGATTTGGGCGCATTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-2315s1c1
Sequence:CCGGGCCACAATGAGGAAACGGTTACTCGAGTAACCGTTTCCTCATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014577.1-3421s1c1
Sequence:CCGGGCAGACCAAGTCTGATGAGAACTCGAGTTCTCATCAGACTTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-1846s1c1
Sequence:CCGGCCCGCAGAGGTTAAATAGGATCTCGAGATCCTATTTAACCTCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014577.1-3510s1c1
Sequence:CCGGCCCTTGGTATTGACGAAACTACTCGAGTAGTTTCGTCAATACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-626s21c1
Sequence:CCGGCGCTTGCACAGGATCAGTATTCTCGAGAATACTGATCCTGTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-1822s21c1
Sequence:CCGGGACCGTGTGCGCTCCTTATATCTCGAGATATAAGGAGCGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014577.1-3523s21c1
Sequence:CCGGCGAAACTATAGACAAGTTAAACTCGAGTTTAACTTGTCTATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-4208s21c1
Sequence:CCGGTGTGCCTCCCAGCGGATTATTCTCGAGAATAATCCGCTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014577.1-2333s21c1
Sequence:CCGGTTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033274
VALIDATED
BRD1 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-444s21c1
Sequence:CCGGCGCTTGCATCGGATCAGTATTCTCGAGAATACTGATCCGATGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3247s21c1
Sequence:GTACCGGGTGCATCTGAATCCAGTATTTCTCGAGAAATACTGGATTCAGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-2151s21c1
Sequence:GTACCGGCTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-4595s21c1
Sequence:GTACCGGAGAATGTGTTGCGAGGTTATACTCGAGTATAACCTCGCAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3522s21c1
Sequence:CCGGTCCTACCCAGCACTGATTATTCTCGAGAATAATCAGTGCTGGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033274
VALIDATED
BRD1 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-444s21c1
Sequence:CCGGCGCTTGCATCGGATCAGTATTCTCGAGAATACTGATCCGATGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3247s21c1
Sequence:GTACCGGGTGCATCTGAATCCAGTATTTCTCGAGAAATACTGGATTCAGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-2151s21c1
Sequence:GTACCGGCTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-4595s21c1
Sequence:GTACCGGAGAATGTGTTGCGAGGTTATACTCGAGTATAACCTCGCAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3522s21c1
Sequence:CCGGTCCTACCCAGCACTGATTATTCTCGAGAATAATCAGTGCTGGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033274
VALIDATED
BRD1 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-444s21c1
Sequence:CCGGCGCTTGCATCGGATCAGTATTCTCGAGAATACTGATCCGATGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3247s21c1
Sequence:GTACCGGGTGCATCTGAATCCAGTATTTCTCGAGAAATACTGGATTCAGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-2151s21c1
Sequence:GTACCGGCTAGAAGCTCAAGGGTATAAACTCGAGTTTATACCCTTGAGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-4595s21c1
Sequence:GTACCGGAGAATGTGTTGCGAGGTTATACTCGAGTATAACCTCGCAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033274.3-3522s21c1
Sequence:CCGGTCCTACCCAGCACTGATTATTCTCGAGAATAATCAGTGCTGGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks