EMAIL THIS PAGE TO A FRIEND

BRD2

bromodomain containing 2

128 Gene Product Result for
Synonyms: D6S113E FSH FSRG1 NAT RING3 RNF3
Gene ID:
Human(6046) Summary: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
Mouse(14312) bromodomain containing 2
Rat(294276) bromodomain containing 2
chicken(417049) bromodomain containing 2
dog(474868) bromodomain containing 2
cow(505358) bromodomain containing 2
domestic cat(101084362) bromodomain containing 2
sheep(101110276) bromodomain containing 2
Domestic Rabbit(100343906) bromodomain containing 2
naked mole-rat(101699681) bromodomain containing 2
domestic guinea pig(100734555) bromodomain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34212 Anti-BRD2 (AB1) antibody produced in rabbit affinity isolated antibody canine, zebrafish, horse, human, rat, bovine, mouse, pig, guinea pig
western blot pricing
AV34211 Anti-BRD2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, canine, horse, rat, pig, human, mouse
western blot pricing
SAB1409608 Anti-BRD2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA042816 Anti-BRD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0066 Goat anti-BRD2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. marmoset, human, rhesus monkey, gibbon, gorilla, bovine
proximity ligation assay, western blot pricing
WH0006046M1 Monoclonal Anti-BRD2 antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0261 Rabbit anti-BRD2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, horse, chimpanzee, marmoset, mouse, bovine, rhesus monkey, gorilla, pig, human, primate
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005104 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113182 Rosetta Predictions human pricing
NM_005104 Rosetta Predictions human pricing
NM_212495 Rosetta Predictions rat pricing
NM_001025387 Rosetta Predictions mouse pricing
NM_010238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325595 predicted 1849
2 SASI_Hs02_00325596 predicted 1815
3 SASI_Hs02_00325597 predicted 3808
4 SASI_Hs02_00325598 predicted 2784
5 SASI_Hs02_00325599 predicted 1974
6 SASI_Hs02_00325600 predicted 2839
7 SASI_Hs02_00325601 predicted 3614
8 SASI_Hs02_00325602 predicted 3624
9 SASI_Hs02_00325603 predicted 2038
10 SASI_Hs02_00325604 predicted 2428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018114 predicted 1950
2 SASI_Hs01_00018115 predicted 1919
3 SASI_Hs01_00018116 predicted 3911
4 SASI_Hs01_00018117 predicted 2888
5 SASI_Hs01_00018118 predicted 2070
6 SASI_Hs01_00018119 predicted 2941
7 SASI_Hs01_00018120 predicted 3717
8 SASI_Hs01_00018121 predicted 3730
9 SASI_Hs01_00018123 predicted 2131
10 SASI_Hs02_00338990 predicted 2526
11 SASI_Hs01_00018122 predicted 2904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270472 predicted 1291
2 SASI_Rn02_00270473 predicted 1866
3 SASI_Rn01_00086982 predicted 1091
4 SASI_Rn01_00086983 predicted 2715
5 SASI_Rn01_00086984 predicted 1235
6 SASI_Rn01_00086985 predicted 1050
7 SASI_Rn01_00086986 predicted 1506
8 SASI_Rn02_00270474 predicted 1511
9 SASI_Rn02_00270475 predicted 2699
10 SASI_Rn01_00086989 predicted 2756
11 SASI_Rn01_00086981 predicted 1127
12 SASI_Rn01_00086987 predicted 1358
13 SASI_Rn01_00086988 predicted 1707
14 SASI_Rn01_00086990 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091655 predicted 2756
2 SASI_Mm01_00091657 predicted 3486
3 SASI_Mm01_00091658 predicted 3580
4 SASI_Mm01_00091659 predicted 2221
5 SASI_Mm01_00091660 predicted 3801
6 SASI_Mm01_00091661 predicted 2371
7 SASI_Mm01_00091662 predicted 3876
8 SASI_Mm01_00091663 predicted 3627
9 SASI_Mm02_00287860 predicted 2649
10 SASI_Mm01_00091664 predicted 2747
11 SASI_Mm01_00091656 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030777 predicted 2743
2 SASI_Mm01_00030778 predicted 2783
3 SASI_Mm01_00030779 predicted 3467
4 SASI_Mm01_00030780 predicted 3563
5 SASI_Mm01_00030781 predicted 2201
6 SASI_Mm02_00318099 predicted 3786
7 SASI_Mm01_00030782 predicted 2360
8 SASI_Mm01_00030783 predicted 3868
9 SASI_Mm01_00030784 predicted 3606
10 SASI_Mm01_00030785 predicted 2724
11 SASI_Mm01_00030786 predicted 3909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005104
VALIDATED
BRD2 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2904s21c1
Sequence:GTACCGGGAAGATGGAGAACCGTGATTACTCGAGTAATCACGGTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4418s21c1
Sequence:GTACCGGGCTGCCCTATTCACTTCTAAGCTCGAGCTTAGAAGTGAATAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2059s21c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-3578s21c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005104.3-3834s21c1
Sequence:CCGGCCGGAAGCCCTACACCATTAACTCGAGTTAATGGTGTAGGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2402s21c1
Sequence:CCGGCTACCACTGTCCTCAACATTCCTCGAGGAATGTTGAGGACAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4254s21c1
Sequence:CCGGGAGGGATGCAGGGACATTTACCTCGAGGTAAATGTCCCTGCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-4183s1c1
Sequence:CCGGCCCTTTGCTGTGACACTTCTTCTCGAGAAGAAGTGTCACAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2401s1c1
Sequence:CCGGCCTACCACTGTCCTCAACATTCTCGAGAATGTTGAGGACAGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2059s1c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3578s1c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3720s1c1
Sequence:CCGGGCCCTCTTTACGTGATTCAAACTCGAGTTTGAATCACGTAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005104.2-2177s1c1
Sequence:CCGGCTGATGATATTGTCCTAATGGCTCGAGCCATTAGGACAATATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005104
VALIDATED
BRD2 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2904s21c1
Sequence:GTACCGGGAAGATGGAGAACCGTGATTACTCGAGTAATCACGGTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4418s21c1
Sequence:GTACCGGGCTGCCCTATTCACTTCTAAGCTCGAGCTTAGAAGTGAATAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2059s21c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-3578s21c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005104.3-3834s21c1
Sequence:CCGGCCGGAAGCCCTACACCATTAACTCGAGTTAATGGTGTAGGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2402s21c1
Sequence:CCGGCTACCACTGTCCTCAACATTCCTCGAGGAATGTTGAGGACAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4254s21c1
Sequence:CCGGGAGGGATGCAGGGACATTTACCTCGAGGTAAATGTCCCTGCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-4183s1c1
Sequence:CCGGCCCTTTGCTGTGACACTTCTTCTCGAGAAGAAGTGTCACAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2401s1c1
Sequence:CCGGCCTACCACTGTCCTCAACATTCTCGAGAATGTTGAGGACAGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2059s1c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3578s1c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3720s1c1
Sequence:CCGGGCCCTCTTTACGTGATTCAAACTCGAGTTTGAATCACGTAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005104.2-2177s1c1
Sequence:CCGGCTGATGATATTGTCCTAATGGCTCGAGCCATTAGGACAATATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005104
VALIDATED
BRD2 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2904s21c1
Sequence:GTACCGGGAAGATGGAGAACCGTGATTACTCGAGTAATCACGGTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4418s21c1
Sequence:GTACCGGGCTGCCCTATTCACTTCTAAGCTCGAGCTTAGAAGTGAATAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2059s21c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-3578s21c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005104.3-3834s21c1
Sequence:CCGGCCGGAAGCCCTACACCATTAACTCGAGTTAATGGTGTAGGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005104.3-2402s21c1
Sequence:CCGGCTACCACTGTCCTCAACATTCCTCGAGGAATGTTGAGGACAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005104.3-4254s21c1
Sequence:CCGGGAGGGATGCAGGGACATTTACCTCGAGGTAAATGTCCCTGCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-4183s1c1
Sequence:CCGGCCCTTTGCTGTGACACTTCTTCTCGAGAAGAAGTGTCACAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2401s1c1
Sequence:CCGGCCTACCACTGTCCTCAACATTCTCGAGAATGTTGAGGACAGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-2059s1c1
Sequence:CCGGCCTATGGACATGGGTACTATTCTCGAGAATAGTACCCATGTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3578s1c1
Sequence:CCGGCCCTGCCTACAGGTTATGATTCTCGAGAATCATAACCTGTAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005104.2-3720s1c1
Sequence:CCGGGCCCTCTTTACGTGATTCAAACTCGAGTTTGAATCACGTAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005104.2-2177s1c1
Sequence:CCGGCTGATGATATTGTCCTAATGGCTCGAGCCATTAGGACAATATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010238
BRD2 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3548s21c1
Sequence:CCGGCCCTCTCTACGTGATTCAAATCTCGAGATTTGAATCACGTAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3660s21c1
Sequence:CCGGCCCGGAAGCCCTACACTATTACTCGAGTAATAGTGTAGGGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-2684s21c1
Sequence:CCGGGATTACCATGACATCATTAAACTCGAGTTTAATGATGTCATGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2715s1c1
Sequence:CCGGCCAGAAGAAATTGAGATTGATCTCGAGATCAATCTCAATTTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1934s1c1
Sequence:CCGGGCTTATGTTCTCCAACTGCTACTCGAGTAGCAGTTGGAGAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-942s1c1
Sequence:CCGGGCTCTGTGGAAGCATCAGTTTCTCGAGAAACTGATGCTTCCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2421s1c1
Sequence:CCGGCAGCCCAAGAAATCTAAGAAACTCGAGTTTCTTAGATTTCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1090s1c1
Sequence:CCGGCCTCAGAATGTATGCAGGATTCTCGAGAATCCTGCATACATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010238
BRD2 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3548s21c1
Sequence:CCGGCCCTCTCTACGTGATTCAAATCTCGAGATTTGAATCACGTAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3660s21c1
Sequence:CCGGCCCGGAAGCCCTACACTATTACTCGAGTAATAGTGTAGGGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-2684s21c1
Sequence:CCGGGATTACCATGACATCATTAAACTCGAGTTTAATGATGTCATGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2715s1c1
Sequence:CCGGCCAGAAGAAATTGAGATTGATCTCGAGATCAATCTCAATTTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1934s1c1
Sequence:CCGGGCTTATGTTCTCCAACTGCTACTCGAGTAGCAGTTGGAGAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-942s1c1
Sequence:CCGGGCTCTGTGGAAGCATCAGTTTCTCGAGAAACTGATGCTTCCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2421s1c1
Sequence:CCGGCAGCCCAAGAAATCTAAGAAACTCGAGTTTCTTAGATTTCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1090s1c1
Sequence:CCGGCCTCAGAATGTATGCAGGATTCTCGAGAATCCTGCATACATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010238
BRD2 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3548s21c1
Sequence:CCGGCCCTCTCTACGTGATTCAAATCTCGAGATTTGAATCACGTAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-3660s21c1
Sequence:CCGGCCCGGAAGCCCTACACTATTACTCGAGTAATAGTGTAGGGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010238.3-2684s21c1
Sequence:CCGGGATTACCATGACATCATTAAACTCGAGTTTAATGATGTCATGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2715s1c1
Sequence:CCGGCCAGAAGAAATTGAGATTGATCTCGAGATCAATCTCAATTTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1934s1c1
Sequence:CCGGGCTTATGTTCTCCAACTGCTACTCGAGTAGCAGTTGGAGAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-942s1c1
Sequence:CCGGGCTCTGTGGAAGCATCAGTTTCTCGAGAAACTGATGCTTCCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-2421s1c1
Sequence:CCGGCAGCCCAAGAAATCTAAGAAACTCGAGTTTCTTAGATTTCTTGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010238.1-1090s1c1
Sequence:CCGGCCTCAGAATGTATGCAGGATTCTCGAGAATCCTGCATACATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks