EMAIL THIS PAGE TO A FRIEND

BRD3

bromodomain containing 3

111 Gene Product Result for
Synonyms: ORFX RING3L
UniProtKB ID: Q15059, B1APD9, Q4G5Y3, Q5T1R7, Q8N5M3, Q92645
Gene ID:
Human(8019) Summary: This gene was identified based on its homology to the gene encoding the RING3 protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes. The function of the encoded protein is not known. [provided by RefSeq, Jul 2008]
Mouse(67382) bromodomain containing 3
Rat(362092) bromodomain containing 3
chicken(427757) bromodomain containing 3
dog(480682) bromodomain containing 3
cow(525051) bromodomain containing 3
Horse(100066434) bromodomain containing 3
domestic cat(101086013) bromodomain containing 3
domestic guinea pig(100718783) bromodomain containing 3
naked mole-rat(101722665) bromodomain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412098 ANTI-BRD3 antibody produced in mouse clone 6C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412360 ANTI-BRD3 antibody produced in mouse clone 6F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108095 Anti-BRD3 antibody produced in rabbit affinity isolated antibody rabbit, canine, rat, human, horse, mouse, bovine, guinea pig, zebrafish
immunohistochemistry, western blot pricing
AV38939 Anti-BRD3 antibody produced in rabbit IgG fraction of antiserum pig, human, guinea pig, rabbit, bovine, rat, canine, mouse, zebrafish, horse
western blot pricing
SAB2100222 Anti-BRD3 antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, chicken, canine, bovine, human, mouse, horse, rabbit, rat
western blot pricing
SAB2104472 Anti-BRD3 antibody produced in rabbit affinity isolated antibody , zebrafish, canine, human, guinea pig, bovine, horse, rabbit, mouse, rat
western blot pricing
HPA051830 Anti-BRD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4503199 Anti-BRD3, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
WH0008019M1 Monoclonal Anti-BRD3 antibody produced in mouse clone 6E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404567 Monoclonal Anti-BRD3, (C-terminal) antibody produced in mouse clone 7G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007371 Rosetta Predictions human pricing
NM_001108575 Rosetta Predictions rat pricing
NM_001113573 Rosetta Predictions mouse pricing
NM_001113574 Rosetta Predictions mouse pricing
NM_023336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086811 predicted 500
2 SASI_Hs01_00086812 predicted 489
3 SASI_Hs01_00086813 predicted 486
4 SASI_Hs01_00086814 predicted 2030
5 SASI_Hs01_00086815 predicted 2025
6 SASI_Hs01_00086816 predicted 2175
7 SASI_Hs01_00086817 predicted 2182
8 SASI_Hs02_00343501 predicted 2001
9 SASI_Hs01_00086818 predicted 1263
10 SASI_Hs01_00086819 predicted 503
11 SASI_Hs01_00086810 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239989 predicted 560
2 SASI_Rn02_00239990 predicted 566
3 SASI_Rn02_00239991 predicted 2370
4 SASI_Rn02_00239992 predicted 525
5 SASI_Rn02_00239993 predicted 446
6 SASI_Rn02_00239994 predicted 449
7 SASI_Rn02_00239995 predicted 2082
8 SASI_Rn02_00239996 predicted 324
9 SASI_Rn02_00239997 predicted 1350
10 SASI_Rn02_00239998 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308269 predicted 499
2 SASI_Mm02_00308270 predicted 2016
3 SASI_Mm02_00308271 predicted 1922
4 SASI_Mm02_00308272 predicted 552
5 SASI_Mm02_00308273 predicted 442
6 SASI_Mm02_00308274 predicted 2083
7 SASI_Mm02_00308275 predicted 1064
8 SASI_Mm02_00308276 predicted 1340
9 SASI_Mm02_00308277 predicted 2120
10 SASI_Mm02_00308278 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308279 predicted 507
2 SASI_Mm02_00308280 predicted 2066
3 SASI_Mm02_00308281 predicted 924
4 SASI_Mm02_00308282 predicted 552
5 SASI_Mm02_00308283 predicted 439
6 SASI_Mm02_00308284 predicted 541
7 SASI_Mm02_00308285 predicted 2128
8 SASI_Mm02_00308286 predicted 1061
9 SASI_Mm02_00308287 predicted 1340
10 SASI_Mm02_00308288 predicted 2169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174691 predicted 662
2 SASI_Mm01_00174692 predicted 2168
3 SASI_Mm01_00174693 predicted 2083
4 SASI_Mm01_00174694 predicted 716
5 SASI_Mm01_00174695 predicted 601
6 SASI_Mm01_00174697 predicted 2238
7 SASI_Mm01_00174698 predicted 1220
8 SASI_Mm01_00174699 predicted 1497
9 SASI_Mm01_00174700 predicted 2279
10 SASI_Mm02_00327071 predicted 1099
11 SASI_Mm01_00174696 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007371
VALIDATED
BRD3 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2495s1c1
Sequence:CCGGGCGTTAGACTTGATGAGAAGGCTCGAGCCTTCTCATCAAGTCTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007371.2-2006s1c1
Sequence:CCGGCCCACCACTTTGCGGGAACTGCTCGAGCAGTTCCCGCAAAGTGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2610s1c1
Sequence:CCGGGTGAGATTCGTACCGAAGAACCTCGAGGTTCTTCGGTACGAATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2385s1c1
Sequence:CCGGGTGGTTCATATTACTACTTCTCTCGAGAGAAGTAGTAATATGAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-337s1c1
Sequence:CCGGCAAATTGAACCTGCCGGATTACTCGAGTAATCCGGCAGGTTCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007371.2-2689s1c1
Sequence:CCGGCCAAGGAAATGTCTCGGATATCTCGAGATATCCGAGACATTTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-561s1c1
Sequence:CCGGCCCAAGAGGAAGTTGAATTATCTCGAGATAATTCAACTTCCTCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-1282s1c1
Sequence:CCGGGCTGATGTTCTCGAATTGCTACTCGAGTAGCAATTCGAGAACATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2029s1c1
Sequence:CCGGGAGATATGTCAAGTCTTGTTTCTCGAGAAACAAGACTTGACATATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007371
VALIDATED
BRD3 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2495s1c1
Sequence:CCGGGCGTTAGACTTGATGAGAAGGCTCGAGCCTTCTCATCAAGTCTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007371.2-2006s1c1
Sequence:CCGGCCCACCACTTTGCGGGAACTGCTCGAGCAGTTCCCGCAAAGTGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2610s1c1
Sequence:CCGGGTGAGATTCGTACCGAAGAACCTCGAGGTTCTTCGGTACGAATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2385s1c1
Sequence:CCGGGTGGTTCATATTACTACTTCTCTCGAGAGAAGTAGTAATATGAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-337s1c1
Sequence:CCGGCAAATTGAACCTGCCGGATTACTCGAGTAATCCGGCAGGTTCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007371.2-2689s1c1
Sequence:CCGGCCAAGGAAATGTCTCGGATATCTCGAGATATCCGAGACATTTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-561s1c1
Sequence:CCGGCCCAAGAGGAAGTTGAATTATCTCGAGATAATTCAACTTCCTCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-1282s1c1
Sequence:CCGGGCTGATGTTCTCGAATTGCTACTCGAGTAGCAATTCGAGAACATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2029s1c1
Sequence:CCGGGAGATATGTCAAGTCTTGTTTCTCGAGAAACAAGACTTGACATATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007371
VALIDATED
BRD3 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2495s1c1
Sequence:CCGGGCGTTAGACTTGATGAGAAGGCTCGAGCCTTCTCATCAAGTCTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007371.2-2006s1c1
Sequence:CCGGCCCACCACTTTGCGGGAACTGCTCGAGCAGTTCCCGCAAAGTGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2610s1c1
Sequence:CCGGGTGAGATTCGTACCGAAGAACCTCGAGGTTCTTCGGTACGAATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2385s1c1
Sequence:CCGGGTGGTTCATATTACTACTTCTCTCGAGAGAAGTAGTAATATGAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-337s1c1
Sequence:CCGGCAAATTGAACCTGCCGGATTACTCGAGTAATCCGGCAGGTTCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007371.2-2689s1c1
Sequence:CCGGCCAAGGAAATGTCTCGGATATCTCGAGATATCCGAGACATTTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-561s1c1
Sequence:CCGGCCCAAGAGGAAGTTGAATTATCTCGAGATAATTCAACTTCCTCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-1282s1c1
Sequence:CCGGGCTGATGTTCTCGAATTGCTACTCGAGTAGCAATTCGAGAACATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_007371.2-2029s1c1
Sequence:CCGGGAGATATGTCAAGTCTTGTTTCTCGAGAAACAAGACTTGACATATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023336
VALIDATED
BRD3 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-2670s1c1
Sequence:CCGGCCTCTCCCTTAGTAACTTGAACTCGAGTTCAAGTTACTAAGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1900s1c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-516s1c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-517s1c1
Sequence:CCGGCACAGATGATATAGTGCTAATCTCGAGATTAGCACTATATCATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1195s1c1
Sequence:CCGGGCTGCATGACTACCATGACATCTCGAGATGTCATGGTAGTCATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-2086s21c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-1489s21c1
Sequence:CCGGCCGGTTAATGTTCTCGAATTGCTCGAGCAATTCGAGAACATTAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023336.4-2878s21c1
Sequence:CCGGGAAGCTTTGCAAGGGTGTTTCCTCGAGGAAACACCCTTGCAAAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-549s21c1
Sequence:CCGGAGCTGAACCTGCCTGATTATCCTCGAGGATAATCAGGCAGGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-702s21c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023336
VALIDATED
BRD3 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-2670s1c1
Sequence:CCGGCCTCTCCCTTAGTAACTTGAACTCGAGTTCAAGTTACTAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1900s1c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-516s1c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-517s1c1
Sequence:CCGGCACAGATGATATAGTGCTAATCTCGAGATTAGCACTATATCATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1195s1c1
Sequence:CCGGGCTGCATGACTACCATGACATCTCGAGATGTCATGGTAGTCATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-2086s21c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-1489s21c1
Sequence:CCGGCCGGTTAATGTTCTCGAATTGCTCGAGCAATTCGAGAACATTAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023336.4-2878s21c1
Sequence:CCGGGAAGCTTTGCAAGGGTGTTTCCTCGAGGAAACACCCTTGCAAAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-549s21c1
Sequence:CCGGAGCTGAACCTGCCTGATTATCCTCGAGGATAATCAGGCAGGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-702s21c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023336
VALIDATED
BRD3 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-2670s1c1
Sequence:CCGGCCTCTCCCTTAGTAACTTGAACTCGAGTTCAAGTTACTAAGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1900s1c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-516s1c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-517s1c1
Sequence:CCGGCACAGATGATATAGTGCTAATCTCGAGATTAGCACTATATCATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023336.2-1195s1c1
Sequence:CCGGGCTGCATGACTACCATGACATCTCGAGATGTCATGGTAGTCATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-2086s21c1
Sequence:CCGGGCGACAACTTAGCCTTGACATCTCGAGATGTCAAGGCTAAGTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-1489s21c1
Sequence:CCGGCCGGTTAATGTTCTCGAATTGCTCGAGCAATTCGAGAACATTAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023336.4-2878s21c1
Sequence:CCGGGAAGCTTTGCAAGGGTGTTTCCTCGAGGAAACACCCTTGCAAAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-549s21c1
Sequence:CCGGAGCTGAACCTGCCTGATTATCCTCGAGGATAATCAGGCAGGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023336.4-702s21c1
Sequence:CCGGCCACAGATGATATAGTGCTAACTCGAGTTAGCACTATATCATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)