EMAIL THIS PAGE TO A FRIEND

BRD4

bromodomain containing 4

218 Gene Product Result for
Synonyms: CAP HUNK1 HUNKI MCAP
UniProtKB ID: O60885, O60433, Q4G0X8, Q86YS8, Q96PD3
Gene ID:
Human(23476) Summary: The protein encoded by this gene is homologous to the murine protein MCAP, which associates with chromosomes during mitosis, and to the human RING3 protein, a serine/threonine kinase. Each of these proteins contains two bromodomains, a conserved sequence motif which may be involved in chromatin targeting. This gene has been implicated as the chromosome 19 target of translocation t(15;19)(q13;p13.1), which defines an upper respiratory tract carcinoma in young people. Two alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Mouse(57261) bromodomain containing 4
Rat(362844) bromodomain containing 4
Zebrafish(570531) bromodomain containing 4
cow(614048) bromodomain containing 4
Horse(100062072) bromodomain containing 4
domestic cat(101100035) bromodomain containing 4
dog(484869) bromodomain containing 4
chicken(430442) bromodomain containing 4
Thale Cress(2745841) bromodomain 4
naked mole-rat(101723132) bromodomain containing 4
domestic guinea pig(100717142) bromodomain containing 4
sheep(101123297) bromodomain containing 4
Domestic Rabbit(100352214) bromodomain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108521 Anti-BRD4 affinity isolated antibody horse, mouse, pig, rabbit, human, canine, guinea pig, bovine, human
ChIP, immunofluorescence, western blot pricing
HPA015055 Anti-BRD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV39076 Anti-BRD4 antibody produced in rabbit affinity isolated antibody horse, rat, guinea pig, rabbit, human, mouse, bovine, canine
western blot pricing
HPA061646 Anti-BRD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410426 Anti-BRD4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90843 Monoclonal Anti-BRD4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1118, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90841 Monoclonal Anti-BRD4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1115, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
PLA0227 Rabbit anti-BRD4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014299 Rosetta Predictions human pricing
NM_058243 Rosetta Predictions human pricing
XM_001065925 Rosetta Predictions rat pricing
XM_001066148 Rosetta Predictions rat pricing
XM_001077931 Rosetta Predictions rat pricing
XM_343175 Rosetta Predictions rat pricing
NM_020508 Rosetta Predictions mouse pricing
NM_198094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037409 predicted 1448
2 SASI_Hs01_00037410 predicted 497
3 SASI_Hs01_00037411 predicted 569
4 SASI_Hs01_00037413 predicted 502
5 SASI_Hs02_00345387 predicted 615
6 SASI_Hs01_00037414 predicted 281
7 SASI_Hs01_00037415 predicted 528
8 SASI_Hs01_00037416 predicted 1560
9 SASI_Hs01_00037417 predicted 1480
10 SASI_Hs01_00037418 predicted 1467
11 SASI_Hs01_00037412 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126965 predicted 1446
2 SASI_Hs01_00126966 predicted 500
3 SASI_Hs01_00126967 predicted 576
4 SASI_Hs01_00126969 predicted 495
5 SASI_Hs02_00362148 predicted 616
6 SASI_Hs01_00126970 predicted 280
7 SASI_Hs01_00126971 predicted 524
8 SASI_Hs01_00126972 predicted 1558
9 SASI_Hs01_00126973 predicted 1483
10 SASI_Hs01_00126974 predicted 1471
11 SASI_Hs01_00126968 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315745 predicted 1631
2 SASI_Rn02_00315746 predicted 2498
3 SASI_Rn02_00315747 predicted 1627
4 SASI_Rn02_00315748 predicted 2374
5 SASI_Rn02_00315749 predicted 1681
6 SASI_Rn02_00315750 predicted 1032
7 SASI_Rn02_00315751 predicted 3927
8 SASI_Rn02_00315752 predicted 1802
9 SASI_Rn02_00315753 predicted 2429
10 SASI_Rn02_00315754 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316424 predicted 723
2 SASI_Rn02_00316425 predicted 507
3 SASI_Rn02_00316426 predicted 495
4 SASI_Rn02_00316427 predicted 720
5 SASI_Rn02_00316428 predicted 623
6 SASI_Rn02_00316429 predicted 1341
7 SASI_Rn02_00316430 predicted 538
8 SASI_Rn02_00316431 predicted 200
9 SASI_Rn02_00316432 predicted 259
10 SASI_Rn02_00316433 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359060 predicted 378
2 SASI_Rn02_00359061 predicted 1297
3 SASI_Rn02_00359062 predicted 470
4 SASI_Rn02_00359063 predicted 455
5 SASI_Rn02_00359064 predicted 1292
6 SASI_Rn02_00359065 predicted 501
7 SASI_Rn02_00359066 predicted 2044
8 SASI_Rn02_00359067 predicted 1350
9 SASI_Rn02_00359068 predicted 696
10 SASI_Rn02_00359069 predicted 2096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395423 predicted 719
2 SASI_Rn02_00395424 predicted 508
3 SASI_Rn02_00395425 predicted 495
4 SASI_Rn02_00395426 predicted 713
5 SASI_Rn02_00395427 predicted 626
6 SASI_Rn02_00395428 predicted 1344
7 SASI_Rn02_00395429 predicted 544
8 SASI_Rn02_00395430 predicted 203
9 SASI_Rn02_00395431 predicted 250
10 SASI_Rn02_00395432 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116323 predicted 523
2 SASI_Mm01_00116324 predicted 413
3 SASI_Mm02_00325562 predicted 1434
4 SASI_Mm02_00325563 predicted 1466
5 SASI_Mm01_00116326 predicted 298
6 SASI_Mm01_00116327 predicted 1454
7 SASI_Mm01_00116328 predicted 1446
8 SASI_Mm01_00116329 predicted 299
9 SASI_Mm01_00116330 predicted 1506
10 SASI_Mm02_00325564 predicted 524
11 SASI_Mm01_00116325 predicted 1221
12 SASI_Mm01_00116331 predicted 1604
13 SASI_Mm01_00116332 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097957 predicted 519
2 SASI_Mm01_00097958 predicted 412
3 SASI_Mm02_00350816 predicted 1438
4 SASI_Mm02_00350817 predicted 1468
5 SASI_Mm01_00097960 predicted 294
6 SASI_Mm01_00097961 predicted 1452
7 SASI_Mm01_00097962 predicted 1448
8 SASI_Mm01_00097963 predicted 300
9 SASI_Mm01_00097964 predicted 1504
10 SASI_Mm02_00350818 predicted 518
11 SASI_Mm01_00097959 predicted 1219
12 SASI_Mm01_00097965 predicted 1607
13 SASI_Mm01_00097966 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058243
VALIDATED
BRD4 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 4
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-497s21c1
Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058243.2-4626s21c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1707s21c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-646s21c1
Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058243.2-1485s21c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-4263s21c1
Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1420s21c1
Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-4624s1c1
Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-1485s1c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-5005s1c1
Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-1298s1c1
Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-2046s1c1
Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-532s1c1
Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-4270s1c1
Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-4626s1c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-1707s1c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058243
VALIDATED
BRD4 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 4
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-497s21c1
Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058243.2-4626s21c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1707s21c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-646s21c1
Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058243.2-1485s21c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-4263s21c1
Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1420s21c1
Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-4624s1c1
Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-1485s1c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-5005s1c1
Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-1298s1c1
Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-2046s1c1
Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-532s1c1
Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-4270s1c1
Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-4626s1c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-1707s1c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058243
VALIDATED
BRD4 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 4
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-497s21c1
Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058243.2-4626s21c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1707s21c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-646s21c1
Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058243.2-1485s21c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-4263s21c1
Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_058243.2-1420s21c1
Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-4624s1c1
Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-1485s1c1
Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058243.1-5005s1c1
Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-1298s1c1
Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-2046s1c1
Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058243.1-532s1c1
Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058243.1-4270s1c1
Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-4626s1c1
Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058243.1-1707s1c1
Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198094
VALIDATED
BRD4 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-530s21c1
Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-2103s21c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-1600s21c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198094.2-2430s21c1
Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2511s1c1
Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198094.1-520s1c1
Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2224s1c1
Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-1586s1c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2089s1c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198094
VALIDATED
BRD4 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-530s21c1
Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-2103s21c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-1600s21c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198094.2-2430s21c1
Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2511s1c1
Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198094.1-520s1c1
Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2224s1c1
Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-1586s1c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2089s1c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198094
VALIDATED
BRD4 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-530s21c1
Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-2103s21c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198094.2-1600s21c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198094.2-2430s21c1
Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2511s1c1
Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198094.1-520s1c1
Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2224s1c1
Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-1586s1c1
Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198094.1-2089s1c1
Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks