EMAIL THIS PAGE TO A FRIEND

BRD7

bromodomain containing 7

63 Gene Product Result for
Synonyms: BP75 CELTIX1 NAG4
UniProtKB ID: Q9NPI1, Q4VC09, Q8N2L9, Q96KA4, Q9BV48, Q9UH59
Gene ID:
Human(29117) Summary: This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Mouse(26992) bromodomain containing 7
Rat(361374) bromodomain containing 7
sheep(101116595) bromodomain containing 7
domestic guinea pig(100726981) bromodomain containing 7
naked mole-rat(101711403) bromodomain containing 7
Zebrafish(406675) bromodomain containing 7
cow(526153) bromodomain containing 7
Horse(100059012) bromodomain containing 7
domestic cat(101096370) bromodomain containing 7
dog(478130) bromodomain containing 7
chicken(415730) bromodomain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013263 Rosetta Predictions human pricing
NM_001108440 Rosetta Predictions rat pricing
NM_012047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344484 predicted 1508
2 SASI_Hs01_00175882 predicted 1867
3 SASI_Hs01_00175883 predicted 1617
4 SASI_Hs01_00175884 predicted 1585
5 SASI_Hs01_00175886 predicted 1531
6 SASI_Hs02_00344485 predicted 1615
7 SASI_Hs02_00344486 predicted 1950
8 SASI_Hs01_00175887 predicted 1372
9 SASI_Hs01_00175888 predicted 1283
10 SASI_Hs01_00175889 predicted 1437
11 SASI_Hs01_00175880 predicted 1202
12 SASI_Hs01_00175881 predicted 1301
13 SASI_Hs01_00175885 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238659 predicted 975
2 SASI_Rn02_00238660 predicted 962
3 SASI_Rn02_00238661 predicted 1311
4 SASI_Rn02_00238662 predicted 1089
5 SASI_Rn02_00238663 predicted 712
6 SASI_Rn02_00238664 predicted 1146
7 SASI_Rn02_00238665 predicted 735
8 SASI_Rn02_00238666 predicted 924
9 SASI_Rn02_00238667 predicted 998
10 SASI_Rn02_00238668 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322018 predicted 815
2 SASI_Mm01_00180915 predicted 1435
3 SASI_Mm01_00180916 predicted 1700
4 SASI_Mm01_00180918 predicted 838
5 SASI_Mm01_00180919 predicted 1452
6 SASI_Mm01_00180920 predicted 1557
7 SASI_Mm01_00180921 predicted 1189
8 SASI_Mm01_00180922 predicted 928
9 SASI_Mm01_00180923 predicted 1612
10 SASI_Mm01_00180924 predicted 805
11 SASI_Mm01_00180917 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013263
VALIDATED
BRD7 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1385s1c1
Sequence:CCGGCCAAGTGATTTCAGCATCCATCTCGAGATGGATGCTGAAATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1823s1c1
Sequence:CCGGGCTGAACAAGTGACCAATAATCTCGAGATTATTGGTCACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-1445s1c1
Sequence:CCGGGCAGATAGTTTACTGGATGTTCTCGAGAACATCCAGTAAACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1964s1c1
Sequence:CCGGGAAGACACTGAAGAACCTAAACTCGAGTTTAGGTTCTTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-1859s1c1
Sequence:CCGGCAGCAAGTAACTCCAGGTGATCTCGAGATCACCTGGAGTTACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-100s1c1
Sequence:CCGGCAAACACCTCTACGAGGAGTACTCGAGTACTCCTCGTAGAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-311s1c1
Sequence:CCGGCGGAGAAGAGTTAAGGAGGATCTCGAGATCCTCCTTAACTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-487s21c1
Sequence:CCGGGAATCAACTGATGAGACAATTCTCGAGAATTGTCTCATCAGTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1436s21c1
Sequence:CCGGTATGTCATGGCAGATAGTTTACTCGAGTAAACTATCTGCCATGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1277s21c1
Sequence:CCGGTATGGGCCCTACAGTTCTTATCTCGAGATAAGAACTGTAGGGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013263
VALIDATED
BRD7 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1385s1c1
Sequence:CCGGCCAAGTGATTTCAGCATCCATCTCGAGATGGATGCTGAAATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1823s1c1
Sequence:CCGGGCTGAACAAGTGACCAATAATCTCGAGATTATTGGTCACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-1445s1c1
Sequence:CCGGGCAGATAGTTTACTGGATGTTCTCGAGAACATCCAGTAAACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1964s1c1
Sequence:CCGGGAAGACACTGAAGAACCTAAACTCGAGTTTAGGTTCTTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-1859s1c1
Sequence:CCGGCAGCAAGTAACTCCAGGTGATCTCGAGATCACCTGGAGTTACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-100s1c1
Sequence:CCGGCAAACACCTCTACGAGGAGTACTCGAGTACTCCTCGTAGAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-311s1c1
Sequence:CCGGCGGAGAAGAGTTAAGGAGGATCTCGAGATCCTCCTTAACTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-487s21c1
Sequence:CCGGGAATCAACTGATGAGACAATTCTCGAGAATTGTCTCATCAGTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1436s21c1
Sequence:CCGGTATGTCATGGCAGATAGTTTACTCGAGTAAACTATCTGCCATGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1277s21c1
Sequence:CCGGTATGGGCCCTACAGTTCTTATCTCGAGATAAGAACTGTAGGGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013263
VALIDATED
BRD7 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1385s1c1
Sequence:CCGGCCAAGTGATTTCAGCATCCATCTCGAGATGGATGCTGAAATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1823s1c1
Sequence:CCGGGCTGAACAAGTGACCAATAATCTCGAGATTATTGGTCACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-1445s1c1
Sequence:CCGGGCAGATAGTTTACTGGATGTTCTCGAGAACATCCAGTAAACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013263.2-1964s1c1
Sequence:CCGGGAAGACACTGAAGAACCTAAACTCGAGTTTAGGTTCTTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-1859s1c1
Sequence:CCGGCAGCAAGTAACTCCAGGTGATCTCGAGATCACCTGGAGTTACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013263.2-100s1c1
Sequence:CCGGCAAACACCTCTACGAGGAGTACTCGAGTACTCCTCGTAGAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013263.2-311s1c1
Sequence:CCGGCGGAGAAGAGTTAAGGAGGATCTCGAGATCCTCCTTAACTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-487s21c1
Sequence:CCGGGAATCAACTGATGAGACAATTCTCGAGAATTGTCTCATCAGTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1436s21c1
Sequence:CCGGTATGTCATGGCAGATAGTTTACTCGAGTAAACTATCTGCCATGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013263.2-1277s21c1
Sequence:CCGGTATGGGCCCTACAGTTCTTATCTCGAGATAAGAACTGTAGGGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012047
VALIDATED
BRD7 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1444s1c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-1565s1c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-780s1c1
Sequence:CCGGCCAGTCCATAGAAGAACTAAACTCGAGTTTAGTTCTTCTATGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1801s1c1
Sequence:CCGGGCTGAAGTCTTTGACTCCGAACTCGAGTTCGGAGTCAAAGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-705s1c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012047.1-1565s21c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.2-1502s21c1
Sequence:CCGGGCAAAGATGATTCTGATTTAACTCGAGTTAAATCAGAATCATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-705s21c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-1444s21c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-457s21c1
Sequence:CCGGAGAAGAGTCAAGGAGGATAAACTCGAGTTTATCCTCCTTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-842s21c1
Sequence:CCGGATAAGCCAGAGACCATTTATTCTCGAGAATAAATGGTCTCTGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012047
VALIDATED
BRD7 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1444s1c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-1565s1c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-780s1c1
Sequence:CCGGCCAGTCCATAGAAGAACTAAACTCGAGTTTAGTTCTTCTATGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1801s1c1
Sequence:CCGGGCTGAAGTCTTTGACTCCGAACTCGAGTTCGGAGTCAAAGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-705s1c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012047.1-1565s21c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.2-1502s21c1
Sequence:CCGGGCAAAGATGATTCTGATTTAACTCGAGTTAAATCAGAATCATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-705s21c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-1444s21c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-457s21c1
Sequence:CCGGAGAAGAGTCAAGGAGGATAAACTCGAGTTTATCCTCCTTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-842s21c1
Sequence:CCGGATAAGCCAGAGACCATTTATTCTCGAGAATAAATGGTCTCTGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012047
VALIDATED
BRD7 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1444s1c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-1565s1c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012047.1-780s1c1
Sequence:CCGGCCAGTCCATAGAAGAACTAAACTCGAGTTTAGTTCTTCTATGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-1801s1c1
Sequence:CCGGGCTGAAGTCTTTGACTCCGAACTCGAGTTCGGAGTCAAAGACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012047.1-705s1c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012047.1-1565s21c1
Sequence:CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.2-1502s21c1
Sequence:CCGGGCAAAGATGATTCTGATTTAACTCGAGTTAAATCAGAATCATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-705s21c1
Sequence:CCGGGCCTGGCTACTCCATGATTATCTCGAGATAATCATGGAGTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-1444s21c1
Sequence:CCGGCCACATTATGACTCTACATTTCTCGAGAAATGTAGAGTCATAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-457s21c1
Sequence:CCGGAGAAGAGTCAAGGAGGATAAACTCGAGTTTATCCTCCTTGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012047.1-842s21c1
Sequence:CCGGATAAGCCAGAGACCATTTATTCTCGAGAATAAATGGTCTCTGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks