EMAIL THIS PAGE TO A FRIEND

BRD8

bromodomain containing 8

84 Gene Product Result for
Synonyms: SMAP SMAP2 p120
UniProtKB ID: Q9H0E9, O43178, Q15355, Q58AB0, Q59GN0, Q969M9
Gene ID:
Human(10902) Summary: The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Three alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(78656) bromodomain containing 8
Rat(291691) bromodomain containing 8
Zebrafish(337414) bromodomain containing 8
fruit fly(43460) CG14514 gene product from transcript CG14514-RA
chicken(416219) bromodomain containing 8
dog(474692) bromodomain containing 8
domestic cat(101085432) bromodomain containing 8
Horse(100062423) bromodomain containing 8
cow(539896) bromodomain containing 8
naked mole-rat(101710752) bromodomain containing 8
domestic guinea pig(100719288) bromodomain containing 8
sheep(101108568) bromodomain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006696 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006696 Rosetta Predictions human pricing
NM_139199 Rosetta Predictions human pricing
NM_183359 Rosetta Predictions human pricing
NM_001008509 Rosetta Predictions rat pricing
NM_030147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131635 predicted 2223
2 SASI_Hs01_00131636 predicted 1473
3 SASI_Hs01_00131638 predicted 1927
4 SASI_Hs01_00131639 predicted 2436
5 SASI_Hs01_00131640 predicted 1826
6 SASI_Hs02_00342118 predicted 2163
7 SASI_Hs01_00131641 predicted 1527
8 SASI_Hs01_00131642 predicted 2010
9 SASI_Hs01_00131643 predicted 2379
10 SASI_Hs01_00131644 predicted 2582
11 SASI_Hs01_00131637 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157419 predicted 2006
2 SASI_Hs01_00157420 predicted 1249
3 SASI_Hs01_00157422 predicted 1709
4 SASI_Hs01_00157423 predicted 2221
5 SASI_Hs01_00157424 predicted 1602
6 SASI_Hs02_00364226 predicted 1943
7 SASI_Hs01_00157425 predicted 1316
8 SASI_Hs01_00157426 predicted 1797
9 SASI_Hs01_00157427 predicted 2158
10 SASI_Hs01_00157428 predicted 2356
11 SASI_Hs01_00157421 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209396 predicted 2105
2 SASI_Hs01_00209397 predicted 1346
3 SASI_Hs01_00209399 predicted 1805
4 SASI_Hs01_00209400 predicted 2318
5 SASI_Hs01_00209401 predicted 1704
6 SASI_Hs02_00371272 predicted 2046
7 SASI_Hs01_00209402 predicted 1406
8 SASI_Hs01_00209403 predicted 1890
9 SASI_Hs01_00209404 predicted 2260
10 SASI_Hs01_00209405 predicted 2456
11 SASI_Hs01_00209398 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088538 predicted 277
2 SASI_Rn01_00088539 predicted 2267
3 SASI_Rn01_00088540 predicted 691
4 SASI_Rn01_00088542 predicted 1511
5 SASI_Rn01_00088543 predicted 1930
6 SASI_Rn01_00088544 predicted 1380
7 SASI_Rn01_00088545 predicted 221
8 SASI_Rn01_00088546 predicted 2479
9 SASI_Rn01_00088547 predicted 2649
10 SASI_Rn02_00199181 predicted 1826
11 SASI_Rn01_00088541 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189584 predicted 833
2 SASI_Mm01_00189585 predicted 3140
3 SASI_Mm01_00189586 predicted 857
4 SASI_Mm01_00189587 predicted 466
5 SASI_Mm01_00189588 predicted 1115
6 SASI_Mm01_00189589 predicted 1670
7 SASI_Mm01_00189590 predicted 2641
8 SASI_Mm01_00189593 predicted 2681
9 SASI_Mm02_00336560 predicted 3204
10 SASI_Mm02_00336561 predicted 3077
11 SASI_Mm01_00189591 predicted 1545
12 SASI_Mm01_00189592 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030147
VALIDATED
BRD8 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2417s21c1
Sequence:CCGGGGATCAAGGAGAAGGCTATTTCTCGAGAAATAGCCTTCTCCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-3181s21c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2037s21c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2723s21c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030147.2-1660s21c1
Sequence:CCGGTAGCGGAGAAGATGGATATTGCTCGAGCAATATCCATCTTCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-3181s1c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2723s1c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2037s1c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-2793s1c1
Sequence:CCGGCGTGACATCATGCTGATGTTTCTCGAGAAACATCAGCATGATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-531s1c1
Sequence:CCGGGAAGATGTTATTGTTCGCAAACTCGAGTTTGCGAACAATAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030147
VALIDATED
BRD8 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2417s21c1
Sequence:CCGGGGATCAAGGAGAAGGCTATTTCTCGAGAAATAGCCTTCTCCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-3181s21c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2037s21c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2723s21c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030147.2-1660s21c1
Sequence:CCGGTAGCGGAGAAGATGGATATTGCTCGAGCAATATCCATCTTCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-3181s1c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2723s1c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2037s1c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-2793s1c1
Sequence:CCGGCGTGACATCATGCTGATGTTTCTCGAGAAACATCAGCATGATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-531s1c1
Sequence:CCGGGAAGATGTTATTGTTCGCAAACTCGAGTTTGCGAACAATAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030147
VALIDATED
BRD8 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2417s21c1
Sequence:CCGGGGATCAAGGAGAAGGCTATTTCTCGAGAAATAGCCTTCTCCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-3181s21c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2037s21c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030147.2-2723s21c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030147.2-1660s21c1
Sequence:CCGGTAGCGGAGAAGATGGATATTGCTCGAGCAATATCCATCTTCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-3181s1c1
Sequence:CCGGCCACACTTGATCTTAGTCAAACTCGAGTTTGACTAAGATCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2723s1c1
Sequence:CCGGGCCTATGGATTTGTCAACTATCTCGAGATAGTTGACAAATCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030147.2-2037s1c1
Sequence:CCGGGCTGAGATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-2793s1c1
Sequence:CCGGCGTGACATCATGCTGATGTTTCTCGAGAAACATCAGCATGATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030147.2-531s1c1
Sequence:CCGGGAAGATGTTATTGTTCGCAAACTCGAGTTTGCGAACAATAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006696
VALIDATED
BRD8 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-334s21c1
Sequence:CCGGAGATGTTATTGTTCGGAAATTCTCGAGAATTTCCGAACAATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-3056s21c1
Sequence:CCGGGAGAGTTGGAGTAGCACAATTCTCGAGAATTGTGCTACTCCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006696.3-2583s21c1
Sequence:GTACCGGCTGAATTTCAGCGTGACATTACTCGAGTAATGTCACGCTGAAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-2526s21c1
Sequence:CCGGCTATGGATTTGTCAACTATTACTCGAGTAATAGTTGACAAATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-116s21c1
Sequence:CCGGATCCGAGAGAAGCTATGTTTACTCGAGTAAACATAGCTTCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-2594s1c1
Sequence:CCGGCGTGACATTATGCTGATGTTTCTCGAGAAACATCAGCATAATGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-1481s1c1
Sequence:CCGGGCTGTGTCTTACACAGGTGAACTCGAGTTCACCTGTGTAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-365s1c1
Sequence:CCGGCGAGTTGAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTCAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-1838s1c1
Sequence:CCGGGCCGAAATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006696
VALIDATED
BRD8 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-334s21c1
Sequence:CCGGAGATGTTATTGTTCGGAAATTCTCGAGAATTTCCGAACAATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-3056s21c1
Sequence:CCGGGAGAGTTGGAGTAGCACAATTCTCGAGAATTGTGCTACTCCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006696.3-2583s21c1
Sequence:GTACCGGCTGAATTTCAGCGTGACATTACTCGAGTAATGTCACGCTGAAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-2526s21c1
Sequence:CCGGCTATGGATTTGTCAACTATTACTCGAGTAATAGTTGACAAATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-116s21c1
Sequence:CCGGATCCGAGAGAAGCTATGTTTACTCGAGTAAACATAGCTTCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-2594s1c1
Sequence:CCGGCGTGACATTATGCTGATGTTTCTCGAGAAACATCAGCATAATGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-1481s1c1
Sequence:CCGGGCTGTGTCTTACACAGGTGAACTCGAGTTCACCTGTGTAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-365s1c1
Sequence:CCGGCGAGTTGAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTCAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-1838s1c1
Sequence:CCGGGCCGAAATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006696
VALIDATED
BRD8 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-334s21c1
Sequence:CCGGAGATGTTATTGTTCGGAAATTCTCGAGAATTTCCGAACAATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-3056s21c1
Sequence:CCGGGAGAGTTGGAGTAGCACAATTCTCGAGAATTGTGCTACTCCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006696.3-2583s21c1
Sequence:GTACCGGCTGAATTTCAGCGTGACATTACTCGAGTAATGTCACGCTGAAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-2526s21c1
Sequence:CCGGCTATGGATTTGTCAACTATTACTCGAGTAATAGTTGACAAATCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006696.3-116s21c1
Sequence:CCGGATCCGAGAGAAGCTATGTTTACTCGAGTAAACATAGCTTCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-2594s1c1
Sequence:CCGGCGTGACATTATGCTGATGTTTCTCGAGAAACATCAGCATAATGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006696.3-1481s1c1
Sequence:CCGGGCTGTGTCTTACACAGGTGAACTCGAGTTCACCTGTGTAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-365s1c1
Sequence:CCGGCGAGTTGAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTCAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006696.3-1838s1c1
Sequence:CCGGGCCGAAATAGTAGCTGGAGTTCTCGAGAACTCCAGCTACTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks