EMAIL THIS PAGE TO A FRIEND

BRD9

bromodomain containing 9

88 Gene Product Result for
Synonyms: LAVS3040 PRO9856
Gene ID:
Mouse(105246) bromodomain containing 9
Rat(308067) bromodomain containing 9
sheep(101110363) bromodomain containing 9
domestic guinea pig(100733558) bromodomain containing 9
naked mole-rat(101703221) bromodomain containing 9
Zebrafish(393245) bromodomain containing 9
chicken(420799) bromodomain containing 9
domestic cat(101095796) bromodomain containing 9
cow(615865) bromodomain containing 9
Horse(100057849) bromodomain containing 9
dog(609435) bromodomain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34803 Anti-BRD9 (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, human, chicken, zebrafish, rat, mouse
western blot pricing
AV34832 Anti-BRD9 (AB2) antibody produced in rabbit IgG fraction of antiserum rat, human, mouse, rabbit, guinea pig, horse, canine, zebrafish
western blot pricing
SAB2107920 Anti-BRD9 antibody produced in rabbit IgG fraction of antiserum bovine, canine, rat, guinea pig, horse, rabbit, human, mouse, zebrafish
western blot pricing
HPA023197 Anti-BRD9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009877 Rosetta Predictions human pricing
NM_023924 Rosetta Predictions human pricing
NM_001107453 Rosetta Predictions rat pricing
NM_001024508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160988 predicted 1400
2 SASI_Hs01_00160989 predicted 1015
3 SASI_Hs01_00160990 predicted 1946
4 SASI_Hs01_00160991 predicted 1294
5 SASI_Hs01_00160992 predicted 1150
6 SASI_Hs01_00160993 predicted 1018
7 SASI_Hs01_00160994 predicted 1323
8 SASI_Hs01_00160995 predicted 1410
9 SASI_Hs01_00160997 predicted 1204
10 SASI_Hs02_00305693 predicted 1008
11 SASI_Hs01_00160996 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118636 predicted 1865
2 SASI_Hs01_00118637 predicted 1480
3 SASI_Hs01_00118638 predicted 2414
4 SASI_Hs01_00118639 predicted 1763
5 SASI_Hs01_00118640 predicted 1620
6 SASI_Hs01_00118641 predicted 1489
7 SASI_Hs01_00118642 predicted 1793
8 SASI_Hs01_00118643 predicted 1878
9 SASI_Hs01_00118645 predicted 1671
10 SASI_Hs02_00356379 predicted 1471
11 SASI_Hs01_00118644 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228975 predicted 889
2 SASI_Rn02_00228976 predicted 651
3 SASI_Rn02_00228977 predicted 621
4 SASI_Rn02_00228978 predicted 1133
5 SASI_Rn02_00228979 predicted 663
6 SASI_Rn02_00228980 predicted 1072
7 SASI_Rn02_00228981 predicted 626
8 SASI_Rn02_00228982 predicted 1042
9 SASI_Rn02_00228983 predicted 1048
10 SASI_Rn02_00228984 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040824 predicted 888
2 SASI_Mm02_00287600 predicted 776
3 SASI_Mm02_00287601 predicted 1217
4 SASI_Mm01_00040826 predicted 1180
5 SASI_Mm01_00040827 predicted 611
6 SASI_Mm02_00287602 predicted 1158
7 SASI_Mm01_00040829 predicted 549
8 SASI_Mm01_00040830 predicted 653
9 SASI_Mm02_00287603 predicted 1540
10 SASI_Mm01_00040831 predicted 590
11 SASI_Mm01_00040825 predicted 1099
12 SASI_Mm01_00040828 predicted 608
13 SASI_Mm01_00040832 predicted 584
14 SASI_Mm01_00040833 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023924
VALIDATED
BRD9 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-411s1c1
Sequence:CCGGGAGAGCACACCTATTCAGCAACTCGAGTTGCTGAATAGGTGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-636s1c1
Sequence:CCGGGCAATGACATACAATAGGCCACTCGAGTGGCCTATTGTATGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-817s1c1
Sequence:CCGGCGAGTAGAGAAGTTATCAGCTCTCGAGAGCTGATAACTTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-510s1c1
Sequence:CCGGGCTCCTGGATATTCAATGATACTCGAGTATCATTGAATATCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-737s1c1
Sequence:CCGGCAATGAAGATACAGCTGTTGACTCGAGTCAACAGCTGTATCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023924.3-2306s21c1
Sequence:CCGGAGTCATACGCGAAGGCCATATCTCGAGATATGGCCTTCGCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-846s21c1
Sequence:CCGGACAAGTCAGTTACGGAATTTACTCGAGTAAATTCCGTAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-997s21c1
Sequence:CCGGGAAGCGCAGCATGTCGTTTATCTCGAGATAAACGACATGCTGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-946s21c1
Sequence:CCGGGATCCTTCACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTGAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-771s21c1
Sequence:CCGGCTCCTGGATATTCAATGATAACTCGAGTTATCATTGAATATCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023924
VALIDATED
BRD9 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-411s1c1
Sequence:CCGGGAGAGCACACCTATTCAGCAACTCGAGTTGCTGAATAGGTGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-636s1c1
Sequence:CCGGGCAATGACATACAATAGGCCACTCGAGTGGCCTATTGTATGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-817s1c1
Sequence:CCGGCGAGTAGAGAAGTTATCAGCTCTCGAGAGCTGATAACTTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-510s1c1
Sequence:CCGGGCTCCTGGATATTCAATGATACTCGAGTATCATTGAATATCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-737s1c1
Sequence:CCGGCAATGAAGATACAGCTGTTGACTCGAGTCAACAGCTGTATCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023924.3-2306s21c1
Sequence:CCGGAGTCATACGCGAAGGCCATATCTCGAGATATGGCCTTCGCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-846s21c1
Sequence:CCGGACAAGTCAGTTACGGAATTTACTCGAGTAAATTCCGTAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-997s21c1
Sequence:CCGGGAAGCGCAGCATGTCGTTTATCTCGAGATAAACGACATGCTGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-946s21c1
Sequence:CCGGGATCCTTCACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTGAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-771s21c1
Sequence:CCGGCTCCTGGATATTCAATGATAACTCGAGTTATCATTGAATATCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023924
VALIDATED
BRD9 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-411s1c1
Sequence:CCGGGAGAGCACACCTATTCAGCAACTCGAGTTGCTGAATAGGTGTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-636s1c1
Sequence:CCGGGCAATGACATACAATAGGCCACTCGAGTGGCCTATTGTATGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023924.1-817s1c1
Sequence:CCGGCGAGTAGAGAAGTTATCAGCTCTCGAGAGCTGATAACTTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-510s1c1
Sequence:CCGGGCTCCTGGATATTCAATGATACTCGAGTATCATTGAATATCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023924.1-737s1c1
Sequence:CCGGCAATGAAGATACAGCTGTTGACTCGAGTCAACAGCTGTATCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023924.3-2306s21c1
Sequence:CCGGAGTCATACGCGAAGGCCATATCTCGAGATATGGCCTTCGCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-846s21c1
Sequence:CCGGACAAGTCAGTTACGGAATTTACTCGAGTAAATTCCGTAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-997s21c1
Sequence:CCGGGAAGCGCAGCATGTCGTTTATCTCGAGATAAACGACATGCTGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-946s21c1
Sequence:CCGGGATCCTTCACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTGAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023924.3-771s21c1
Sequence:CCGGCTCCTGGATATTCAATGATAACTCGAGTTATCATTGAATATCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024508
VALIDATED
BRD9 MISSION shRNA Bacterial Glycerol Stock
bromodomain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-598s21c1
Sequence:CCGGTGGACTTTGGCACGATGAAAGCTCGAGCTTTCATCGTGCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024508.2-710s21c1
Sequence:GTACCGGAGACACCGTGTACTACAAATTCTCGAGAATTTGTAGTACACGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-2012s21c1
Sequence:CCGGCACCGAATGGTGTCCAATAAGCTCGAGCTTATTGGACACCATTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-685s21c1
Sequence:CCGGATAATGCGATGACGTACAATACTCGAGTATTGTACGTCATCGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-94s21c1
Sequence:CCGGGCTCGTCCTACGAAGATTATACTCGAGTATAATCTTCGTAGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024508
VALIDATED
BRD9 MISSION shRNA shRNA Plasmid DNA
bromodomain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-598s21c1
Sequence:CCGGTGGACTTTGGCACGATGAAAGCTCGAGCTTTCATCGTGCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024508.2-710s21c1
Sequence:GTACCGGAGACACCGTGTACTACAAATTCTCGAGAATTTGTAGTACACGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-2012s21c1
Sequence:CCGGCACCGAATGGTGTCCAATAAGCTCGAGCTTATTGGACACCATTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-685s21c1
Sequence:CCGGATAATGCGATGACGTACAATACTCGAGTATTGTACGTCATCGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-94s21c1
Sequence:CCGGGCTCGTCCTACGAAGATTATACTCGAGTATAATCTTCGTAGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024508
VALIDATED
BRD9 MISSION shRNA Lentiviral Transduction Particles
bromodomain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-598s21c1
Sequence:CCGGTGGACTTTGGCACGATGAAAGCTCGAGCTTTCATCGTGCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024508.2-710s21c1
Sequence:GTACCGGAGACACCGTGTACTACAAATTCTCGAGAATTTGTAGTACACGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-2012s21c1
Sequence:CCGGCACCGAATGGTGTCCAATAAGCTCGAGCTTATTGGACACCATTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-685s21c1
Sequence:CCGGATAATGCGATGACGTACAATACTCGAGTATTGTACGTCATCGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024508.2-94s21c1
Sequence:CCGGGCTCGTCCTACGAAGATTATACTCGAGTATAATCTTCGTAGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks