EMAIL THIS PAGE TO A FRIEND

BRDT

bromodomain, testis-specific

129 Gene Product Result for
Synonyms: BRD6 CT9
Gene ID:
Human(676) Summary: BRDT is similar to the RING3 protein family. It possesses 2 bromodomain motifs and a PEST sequence (a cluster of proline, glutamic acid, serine, and threonine residues), characteristic of proteins that undergo rapid intracellular degradation. The bromodomain is found in proteins that regulate transcription. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(114642) bromodomain, testis-specific
Rat(305123) bromodomain, testis-specific
Zebrafish(333996) bromodomain, testis-specific
chicken(424506) bromodomain, testis-specific
cow(523971) bromodomain, testis-specific
domestic cat(101096661) bromodomain, testis-specific
dog(479954) bromodomain, testis-specific
naked mole-rat(101719554) bromodomain, testis-specific
domestic guinea pig(100719653) bromodomain, testis-specific
sheep(101116113) bromodomain, testis-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001726 Rosetta Predictions human pricing
NM_207189 Rosetta Predictions human pricing
NM_001012031 Rosetta Predictions rat pricing
XM_001057811 Rosetta Predictions rat pricing
XM_573544 Rosetta Predictions rat pricing
NM_001079873 Rosetta Predictions mouse pricing
NM_054054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332427 predicted 924
2 SASI_Hs01_00080827 predicted 590
3 SASI_Hs01_00080828 predicted 2484
4 SASI_Hs01_00080829 predicted 2521
5 SASI_Hs01_00080830 predicted 730
6 SASI_Hs01_00080832 predicted 1148
7 SASI_Hs01_00080833 predicted 2857
8 SASI_Hs01_00080834 predicted 785
9 SASI_Hs01_00080835 predicted 2575
10 SASI_Hs02_00332428 predicted 905
11 SASI_Hs01_00080831 predicted 1094
12 SASI_Hs01_00080836 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373814 predicted 1134
2 SASI_Hs01_00177439 predicted 792
3 SASI_Hs01_00177440 predicted 2692
4 SASI_Hs01_00177441 predicted 2725
5 SASI_Hs01_00177442 predicted 927
6 SASI_Hs01_00177444 predicted 1348
7 SASI_Hs01_00177445 predicted 3064
8 SASI_Hs01_00177446 predicted 991
9 SASI_Hs01_00177447 predicted 2779
10 SASI_Hs02_00373815 predicted 1111
11 SASI_Hs01_00177443 predicted 1129
12 SASI_Hs01_00177448 predicted 2332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200118 predicted 1296
2 SASI_Rn02_00200119 predicted 483
3 SASI_Rn02_00200120 predicted 1017
4 SASI_Rn02_00200121 predicted 544
5 SASI_Rn02_00200122 predicted 972
6 SASI_Rn02_00200123 predicted 365
7 SASI_Rn02_00200124 predicted 538
8 SASI_Rn02_00200125 predicted 1388
9 SASI_Rn02_00200126 predicted 1406
10 SASI_Rn02_00200127 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287626 predicted 1942
2 SASI_Rn02_00287627 predicted 1386
3 SASI_Rn02_00287628 predicted 1358
4 SASI_Rn02_00287629 predicted 1942
5 SASI_Rn02_00287630 predicted 1352
6 SASI_Rn02_00287631 predicted 2818
7 SASI_Rn02_00287632 predicted 501
8 SASI_Rn02_00287633 predicted 1040
9 SASI_Rn02_00287634 predicted 574
10 SASI_Rn02_00287635 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400474 predicted 1947
2 SASI_Rn02_00400475 predicted 1383
3 SASI_Rn02_00400476 predicted 1352
4 SASI_Rn02_00400477 predicted 1935
5 SASI_Rn02_00400478 predicted 1344
6 SASI_Rn02_00400479 predicted 2821
7 SASI_Rn02_00400480 predicted 505
8 SASI_Rn02_00400481 predicted 1034
9 SASI_Rn02_00400482 predicted 573
10 SASI_Rn02_00400483 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293162 predicted 634
2 SASI_Mm02_00293163 predicted 606
3 SASI_Mm02_00293164 predicted 1349
4 SASI_Mm02_00293165 predicted 606
5 SASI_Mm02_00293166 predicted 989
6 SASI_Mm02_00293167 predicted 664
7 SASI_Mm02_00293168 predicted 859
8 SASI_Mm02_00293169 predicted 573
9 SASI_Mm02_00293170 predicted 380
10 SASI_Mm02_00293171 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337968 predicted 932
2 SASI_Mm01_00163526 predicted 636
3 SASI_Mm02_00337969 predicted 663
4 SASI_Mm02_00337970 predicted 491
5 SASI_Mm02_00337971 predicted 608
6 SASI_Mm02_00337972 predicted 989
7 SASI_Mm02_00337973 predicted 859
8 SASI_Mm02_00337974 predicted 574
9 SASI_Mm01_00163534 predicted 385
10 SASI_Mm02_00337975 predicted 353
11 SASI_Mm01_00163525 predicted 1323
12 SASI_Mm01_00163527 predicted 1369
13 SASI_Mm01_00163528 predicted 1921
14 SASI_Mm01_00163529 predicted 3004
15 SASI_Mm01_00163530 predicted 2647
16 SASI_Mm01_00163531 predicted 2806
17 SASI_Mm01_00163532 predicted 1585
18 SASI_Mm01_00163533 predicted 2973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001726
VALIDATED
BRDT MISSION shRNA Bacterial Glycerol Stock
bromodomain, testis-specific
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1470s21c1
Sequence:GTACCGGAGTACCTTTCCGTAAGCTAAACTCGAGTTTAGCTTACGGAAAGGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2249s21c1
Sequence:CCGGGCGTCACACAGATAGGATATTCTCGAGAATATCCTATCTGTGTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-861s21c1
Sequence:CCGGAGTGGCACTGCCACCTATAAACTCGAGTTTATAGGTGGCAGTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1031s21c1
Sequence:CCGGATAATCCTGTTGACGTTAATGCTCGAGCATTAACGTCAACAGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1155s21c1
Sequence:CCGGTGCGGCAGATGTTAGATTAATCTCGAGATTAATCTAACATCTGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2344s21c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.1-2954s1c1
Sequence:CCGGCTCAGTTTTTAAATTAACCATCTCGAGATGGTTAATTTAAAAACTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1632s1c1
Sequence:CCGGCCTATGAACTATGATGAGAAACTCGAGTTTCTCATCATAGTTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-2117s1c1
Sequence:CCGGCCCTAAGTTTACAGAAGTAAACTCGAGTTTACTTCTGTAAACTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-629s1c1
Sequence:CCGGGCAAGAAATTCCTTCTGTATTCTCGAGAATACAGAAGGAATTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1053s1c1
Sequence:CCGGCCGATGGATCTTGGAACTATTCTCGAGAATAGTTCCAAGATCCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2822s1c1
Sequence:CCGGGCTTCTCAAAGACCGTGATTTCTCGAGAAATCACGGTCTTTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-284s1c1
Sequence:CCGGGAAACTACAGTTGCCTGATTACTCGAGTAATCAGGCAACTGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-766s1c1
Sequence:CCGGCTGCAACTTCAGCAGTTAAAGCTCGAGCTTTAACTGCTGAAGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-2905s1c1
Sequence:CCGGCCCTTCAAAGTGACATTATGACTCGAGTCATAATGTCACTTTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2791s1c1
Sequence:CCGGCATCAGAAGCTCAAGATAAATCTCGAGATTTATCTTGAGCTTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-2307s1c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001726
VALIDATED
BRDT MISSION shRNA shRNA Plasmid DNA
bromodomain, testis-specific
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1470s21c1
Sequence:GTACCGGAGTACCTTTCCGTAAGCTAAACTCGAGTTTAGCTTACGGAAAGGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2249s21c1
Sequence:CCGGGCGTCACACAGATAGGATATTCTCGAGAATATCCTATCTGTGTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-861s21c1
Sequence:CCGGAGTGGCACTGCCACCTATAAACTCGAGTTTATAGGTGGCAGTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1031s21c1
Sequence:CCGGATAATCCTGTTGACGTTAATGCTCGAGCATTAACGTCAACAGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1155s21c1
Sequence:CCGGTGCGGCAGATGTTAGATTAATCTCGAGATTAATCTAACATCTGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2344s21c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.1-2954s1c1
Sequence:CCGGCTCAGTTTTTAAATTAACCATCTCGAGATGGTTAATTTAAAAACTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1632s1c1
Sequence:CCGGCCTATGAACTATGATGAGAAACTCGAGTTTCTCATCATAGTTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-2117s1c1
Sequence:CCGGCCCTAAGTTTACAGAAGTAAACTCGAGTTTACTTCTGTAAACTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-629s1c1
Sequence:CCGGGCAAGAAATTCCTTCTGTATTCTCGAGAATACAGAAGGAATTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1053s1c1
Sequence:CCGGCCGATGGATCTTGGAACTATTCTCGAGAATAGTTCCAAGATCCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2822s1c1
Sequence:CCGGGCTTCTCAAAGACCGTGATTTCTCGAGAAATCACGGTCTTTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-284s1c1
Sequence:CCGGGAAACTACAGTTGCCTGATTACTCGAGTAATCAGGCAACTGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-766s1c1
Sequence:CCGGCTGCAACTTCAGCAGTTAAAGCTCGAGCTTTAACTGCTGAAGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-2905s1c1
Sequence:CCGGCCCTTCAAAGTGACATTATGACTCGAGTCATAATGTCACTTTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2791s1c1
Sequence:CCGGCATCAGAAGCTCAAGATAAATCTCGAGATTTATCTTGAGCTTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-2307s1c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001726
VALIDATED
BRDT MISSION shRNA Lentiviral Transduction Particles
bromodomain, testis-specific
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1470s21c1
Sequence:GTACCGGAGTACCTTTCCGTAAGCTAAACTCGAGTTTAGCTTACGGAAAGGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2249s21c1
Sequence:CCGGGCGTCACACAGATAGGATATTCTCGAGAATATCCTATCTGTGTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-861s21c1
Sequence:CCGGAGTGGCACTGCCACCTATAAACTCGAGTTTATAGGTGGCAGTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1031s21c1
Sequence:CCGGATAATCCTGTTGACGTTAATGCTCGAGCATTAACGTCAACAGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-1155s21c1
Sequence:CCGGTGCGGCAGATGTTAGATTAATCTCGAGATTAATCTAACATCTGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001726.3-2344s21c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.1-2954s1c1
Sequence:CCGGCTCAGTTTTTAAATTAACCATCTCGAGATGGTTAATTTAAAAACTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1632s1c1
Sequence:CCGGCCTATGAACTATGATGAGAAACTCGAGTTTCTCATCATAGTTCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-2117s1c1
Sequence:CCGGCCCTAAGTTTACAGAAGTAAACTCGAGTTTACTTCTGTAAACTTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-629s1c1
Sequence:CCGGGCAAGAAATTCCTTCTGTATTCTCGAGAATACAGAAGGAATTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.1-1053s1c1
Sequence:CCGGCCGATGGATCTTGGAACTATTCTCGAGAATAGTTCCAAGATCCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2822s1c1
Sequence:CCGGGCTTCTCAAAGACCGTGATTTCTCGAGAAATCACGGTCTTTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-284s1c1
Sequence:CCGGGAAACTACAGTTGCCTGATTACTCGAGTAATCAGGCAACTGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-766s1c1
Sequence:CCGGCTGCAACTTCAGCAGTTAAAGCTCGAGCTTTAACTGCTGAAGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001726.2-2905s1c1
Sequence:CCGGCCCTTCAAAGTGACATTATGACTCGAGTCATAATGTCACTTTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001726.2-2791s1c1
Sequence:CCGGCATCAGAAGCTCAAGATAAATCTCGAGATTTATCTTGAGCTTCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001726.2-2307s1c1
Sequence:CCGGCACCACCAATTAGCATTTAATCTCGAGATTAAATGCTAATTGGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054054
BRDT MISSION shRNA Bacterial Glycerol Stock
bromodomain, testis-specific
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-496s21c1
Sequence:CCGGTGACTATTACACCATCATAAACTCGAGTTTATGATGGTGTAATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-2623s21c1
Sequence:CCGGAGGTGATTGCAAGCGAGTATTCTCGAGAATACTCGCTTGCAATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-1105s21c1
Sequence:CCGGCAAAGTAACGGAGCAATTAAACTCGAGTTTAATTGCTCCGTTACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-905s21c1
Sequence:CCGGTCGCAGTCTCTGGTCCAAATTCTCGAGAATTTGGACCAGAGACTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054054.1-3234s1c1
Sequence:CCGGCCTCAACTTTAAATGAAAGGTCTCGAGACCTTTCATTTAAAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1470s1c1
Sequence:CCGGCGATGAACCTATTGAGAGTATCTCGAGATACTCTCAATAGGTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1854s1c1
Sequence:CCGGGCCTATGAACTACGATGAGAACTCGAGTTCTCATCGTAGTTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1192s1c1
Sequence:CCGGGCCAAGAAACATTTGCCGTATCTCGAGATACGGCAAATGTTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-529s1c1
Sequence:CCGGCCTGACTATTACACCATCATACTCGAGTATGATGGTGTAATAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054054
BRDT MISSION shRNA shRNA Plasmid DNA
bromodomain, testis-specific
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-496s21c1
Sequence:CCGGTGACTATTACACCATCATAAACTCGAGTTTATGATGGTGTAATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-2623s21c1
Sequence:CCGGAGGTGATTGCAAGCGAGTATTCTCGAGAATACTCGCTTGCAATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-1105s21c1
Sequence:CCGGCAAAGTAACGGAGCAATTAAACTCGAGTTTAATTGCTCCGTTACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-905s21c1
Sequence:CCGGTCGCAGTCTCTGGTCCAAATTCTCGAGAATTTGGACCAGAGACTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054054.1-3234s1c1
Sequence:CCGGCCTCAACTTTAAATGAAAGGTCTCGAGACCTTTCATTTAAAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1470s1c1
Sequence:CCGGCGATGAACCTATTGAGAGTATCTCGAGATACTCTCAATAGGTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1854s1c1
Sequence:CCGGGCCTATGAACTACGATGAGAACTCGAGTTCTCATCGTAGTTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1192s1c1
Sequence:CCGGGCCAAGAAACATTTGCCGTATCTCGAGATACGGCAAATGTTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-529s1c1
Sequence:CCGGCCTGACTATTACACCATCATACTCGAGTATGATGGTGTAATAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054054
BRDT MISSION shRNA Lentiviral Transduction Particles
bromodomain, testis-specific
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-496s21c1
Sequence:CCGGTGACTATTACACCATCATAAACTCGAGTTTATGATGGTGTAATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-2623s21c1
Sequence:CCGGAGGTGATTGCAAGCGAGTATTCTCGAGAATACTCGCTTGCAATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-1105s21c1
Sequence:CCGGCAAAGTAACGGAGCAATTAAACTCGAGTTTAATTGCTCCGTTACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054054.2-905s21c1
Sequence:CCGGTCGCAGTCTCTGGTCCAAATTCTCGAGAATTTGGACCAGAGACTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054054.1-3234s1c1
Sequence:CCGGCCTCAACTTTAAATGAAAGGTCTCGAGACCTTTCATTTAAAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1470s1c1
Sequence:CCGGCGATGAACCTATTGAGAGTATCTCGAGATACTCTCAATAGGTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1854s1c1
Sequence:CCGGGCCTATGAACTACGATGAGAACTCGAGTTCTCATCGTAGTTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-1192s1c1
Sequence:CCGGGCCAAGAAACATTTGCCGTATCTCGAGATACGGCAAATGTTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054054.1-529s1c1
Sequence:CCGGCCTGACTATTACACCATCATACTCGAGTATGATGGTGTAATAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)