EMAIL THIS PAGE TO A FRIEND

BRE

brain and reproductive organ-expressed (TNFRSF1A modulator)

219 Gene Product Result for
Synonyms: BRCC4 BRCC45
Gene ID:
Mouse(107976) brain and reproductive organ-expressed protein
Rat(362704) brain and reproductive organ-expressed (TNFRSF1A modulator)
sheep(101121412) brain and reproductive organ-expressed (TNFRSF1A modulator)
domestic guinea pig(100725666) brain and reproductive organ-expressed (TNFRSF1A modulator)
naked mole-rat(101696560) brain and reproductive organ-expressed (TNFRSF1A modulator)
Zebrafish(550474) brain and reproductive organ-expressed protein
fruit fly(247927) bright eye
chicken(421417) brain and reproductive organ-expressed (TNFRSF1A modulator)
domestic cat(101093767) brain and reproductive organ-expressed (TNFRSF1A modulator)
cow(614152) brain and reproductive organ-expressed (TNFRSF1A modulator)
dog(475711) brain and reproductive organ-expressed (TNFRSF1A modulator)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500451 Anti-BRCC45 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1406849 Anti-BRE antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA017926 Anti-BRE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702006 Anti-BRE antibody produced in rabbit human, mouse
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB2702055 Anti-BRE antibody produced in rabbit human, mouse, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004899 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004899 Rosetta Predictions human pricing
NM_199191 Rosetta Predictions human pricing
NM_199192 Rosetta Predictions human pricing
NM_199193 Rosetta Predictions human pricing
NM_199194 Rosetta Predictions human pricing
NM_199270 Rosetta Predictions rat pricing
NM_144541 Rosetta Predictions mouse pricing
NM_181279 Rosetta Predictions mouse pricing
NM_181280 Rosetta Predictions mouse pricing
NM_181281 Rosetta Predictions mouse pricing
NM_181282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086571 predicted 366
2 SASI_Hs01_00086572 predicted 350
3 SASI_Hs01_00086573 predicted 943
4 SASI_Hs02_00338546 predicted 365
5 SASI_Hs01_00086574 predicted 956
6 SASI_Hs01_00086575 predicted 900
7 SASI_Hs01_00086576 predicted 406
8 SASI_Hs01_00086577 predicted 1647
9 SASI_Hs02_00338547 predicted 960
10 SASI_Hs02_00338548 predicted 360
11 SASI_Hs01_00086570 predicted 996
12 SASI_Hs01_00086578 predicted 1041
13 SASI_Hs01_00086579 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221752 predicted 369
2 SASI_Hs01_00221753 predicted 352
3 SASI_Hs01_00221754 predicted 945
4 SASI_Hs01_00221755 predicted 364
5 SASI_Hs01_00221756 predicted 957
6 SASI_Hs02_00372651 predicted 897
7 SASI_Hs01_00221757 predicted 407
8 SASI_Hs01_00221758 predicted 957
9 SASI_Hs01_00221759 predicted 368
10 SASI_Hs01_00221761 predicted 403
11 SASI_Hs01_00221760 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077213 predicted 363
2 SASI_Hs01_00077214 predicted 356
3 SASI_Hs01_00077215 predicted 944
4 SASI_Hs02_00372652 predicted 367
5 SASI_Hs01_00077216 predicted 956
6 SASI_Hs01_00077217 predicted 900
7 SASI_Hs01_00077218 predicted 406
8 SASI_Hs01_00077219 predicted 1541
9 SASI_Hs02_00372653 predicted 965
10 SASI_Hs02_00372654 predicted 361
11 SASI_Hs01_00077212 predicted 995
12 SASI_Hs01_00077220 predicted 1040
13 SASI_Hs01_00077221 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193537 predicted 1123
2 SASI_Hs01_00193538 predicted 510
3 SASI_Hs01_00193539 predicted 494
4 SASI_Hs01_00193540 predicted 1088
5 SASI_Hs01_00193541 predicted 1096
6 SASI_Hs01_00193542 predicted 1042
7 SASI_Hs01_00193543 predicted 545
8 SASI_Hs01_00193544 predicted 1683
9 SASI_Hs01_00193545 predicted 1178
10 SASI_Hs01_00193546 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198620 predicted 510
2 SASI_Hs01_00198621 predicted 492
3 SASI_Hs01_00198622 predicted 1082
4 SASI_Hs02_00372655 predicted 505
5 SASI_Hs01_00198624 predicted 1096
6 SASI_Hs01_00198625 predicted 1044
7 SASI_Hs01_00198626 predicted 545
8 SASI_Hs02_00372656 predicted 1103
9 SASI_Hs02_00372657 predicted 501
10 SASI_Hs02_00372658 predicted 545
11 SASI_Hs01_00198619 predicted 1134
12 SASI_Hs01_00198623 predicted 1114
13 SASI_Hs01_00198627 predicted 1188
14 SASI_Hs01_00198628 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115843 predicted 858
2 SASI_Rn01_00115844 predicted 1011
3 SASI_Rn01_00115845 predicted 894
4 SASI_Rn02_00270167 predicted 1161
5 SASI_Rn01_00115846 predicted 812
6 SASI_Rn01_00115847 predicted 319
7 SASI_Rn01_00115848 predicted 268
8 SASI_Rn01_00115849 predicted 1215
9 SASI_Rn01_00115850 predicted 1201
10 SASI_Rn01_00115851 predicted 665
11 SASI_Rn01_00115842 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079534 predicted 830
2 SASI_Mm02_00340073 predicted 873
3 SASI_Mm01_00079535 predicted 1022
4 SASI_Mm01_00079536 predicted 865
5 SASI_Mm01_00079537 predicted 1034
6 SASI_Mm01_00079538 predicted 822
7 SASI_Mm02_00340074 predicted 509
8 SASI_Mm01_00079539 predicted 594
9 SASI_Mm01_00079541 predicted 913
10 SASI_Mm01_00079543 predicted 453
11 SASI_Mm01_00079540 predicted 880
12 SASI_Mm01_00079542 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074380 predicted 943
2 SASI_Mm02_00349650 predicted 982
3 SASI_Mm01_00074381 predicted 1131
4 SASI_Mm01_00074382 predicted 976
5 SASI_Mm01_00074383 predicted 1142
6 SASI_Mm01_00074386 predicted 935
7 SASI_Mm02_00349651 predicted 621
8 SASI_Mm01_00074387 predicted 707
9 SASI_Mm02_00349652 predicted 1021
10 SASI_Mm02_00349653 predicted 570
11 SASI_Mm01_00074384 predicted 410
12 SASI_Mm01_00074385 predicted 898
13 SASI_Mm01_00074388 predicted 754
14 SASI_Mm01_00074389 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029100 predicted 840
2 SASI_Mm02_00349654 predicted 883
3 SASI_Mm01_00029101 predicted 1033
4 SASI_Mm01_00029102 predicted 875
5 SASI_Mm01_00029103 predicted 1043
6 SASI_Mm01_00029104 predicted 836
7 SASI_Mm02_00349655 predicted 521
8 SASI_Mm01_00029105 predicted 604
9 SASI_Mm01_00029107 predicted 919
10 SASI_Mm01_00029109 predicted 462
11 SASI_Mm01_00029106 predicted 882
12 SASI_Mm01_00029108 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066498 predicted 673
2 SASI_Mm02_00349656 predicted 719
3 SASI_Mm01_00066499 predicted 865
4 SASI_Mm01_00066500 predicted 703
5 SASI_Mm01_00066501 predicted 880
6 SASI_Mm01_00066502 predicted 672
7 SASI_Mm02_00349657 predicted 352
8 SASI_Mm01_00066503 predicted 438
9 SASI_Mm01_00066505 predicted 763
10 SASI_Mm01_00066507 predicted 297
11 SASI_Mm01_00066504 predicted 719
12 SASI_Mm01_00066506 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349658 predicted 756
2 SASI_Mm02_00349659 predicted 799
3 SASI_Mm02_00349660 predicted 944
4 SASI_Mm02_00349661 predicted 779
5 SASI_Mm02_00349662 predicted 959
6 SASI_Mm02_00349663 predicted 704
7 SASI_Mm02_00349664 predicted 742
8 SASI_Mm02_00349665 predicted 431
9 SASI_Mm02_00349666 predicted 510
10 SASI_Mm02_00349667 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144541
VALIDATED
BRE MISSION shRNA Bacterial Glycerol Stock
brain and reproductive organ-expressed (TNFRSF1A modulator)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-299s1c1
Sequence:CCGGGATTTCATCTTTGGAGAGGATCTCGAGATCCTCTCCAAAGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-97s1c1
Sequence:CCGGCCCATTCATATCAAGCGTGGTCTCGAGACCACGCTTGATATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-584s1c1
Sequence:CCGGCCAGTAGATTTCAGCAACATTCTCGAGAATGTTGCTGAAATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-131s21c1
Sequence:CCGGGTGGGACTGGATGCTACAAACCTCGAGGTTTGTAGCATCCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-899s21c1
Sequence:CCGGGGCACAGGTGTCGTGGAATATCTCGAGATATTCCACGACACCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-105s21c1
Sequence:CCGGTATCAAGCGTGGTCCGAAATGCTCGAGCATTTCGGACCACGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-574s21c1
Sequence:CCGGATTGAAGTTACCAGTAGATTTCTCGAGAAATCTACTGGTAACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-1129s1c1
Sequence:CCGGCAAGAGAGCAAAGGCTTATTTCTCGAGAAATAAGCCTTTGCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-1032s21c1
Sequence:CCGGTTCAGTCAGTCTATCACTTTACTCGAGTAAAGTGATAGACTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144541
VALIDATED
BRE MISSION shRNA shRNA Plasmid DNA
brain and reproductive organ-expressed (TNFRSF1A modulator)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-299s1c1
Sequence:CCGGGATTTCATCTTTGGAGAGGATCTCGAGATCCTCTCCAAAGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-97s1c1
Sequence:CCGGCCCATTCATATCAAGCGTGGTCTCGAGACCACGCTTGATATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-584s1c1
Sequence:CCGGCCAGTAGATTTCAGCAACATTCTCGAGAATGTTGCTGAAATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-131s21c1
Sequence:CCGGGTGGGACTGGATGCTACAAACCTCGAGGTTTGTAGCATCCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-899s21c1
Sequence:CCGGGGCACAGGTGTCGTGGAATATCTCGAGATATTCCACGACACCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-105s21c1
Sequence:CCGGTATCAAGCGTGGTCCGAAATGCTCGAGCATTTCGGACCACGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-574s21c1
Sequence:CCGGATTGAAGTTACCAGTAGATTTCTCGAGAAATCTACTGGTAACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-1129s1c1
Sequence:CCGGCAAGAGAGCAAAGGCTTATTTCTCGAGAAATAAGCCTTTGCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-1032s21c1
Sequence:CCGGTTCAGTCAGTCTATCACTTTACTCGAGTAAAGTGATAGACTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144541
VALIDATED
BRE MISSION shRNA Lentiviral Transduction Particles
brain and reproductive organ-expressed (TNFRSF1A modulator)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-299s1c1
Sequence:CCGGGATTTCATCTTTGGAGAGGATCTCGAGATCCTCTCCAAAGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-97s1c1
Sequence:CCGGCCCATTCATATCAAGCGTGGTCTCGAGACCACGCTTGATATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-584s1c1
Sequence:CCGGCCAGTAGATTTCAGCAACATTCTCGAGAATGTTGCTGAAATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-131s21c1
Sequence:CCGGGTGGGACTGGATGCTACAAACCTCGAGGTTTGTAGCATCCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-899s21c1
Sequence:CCGGGGCACAGGTGTCGTGGAATATCTCGAGATATTCCACGACACCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-105s21c1
Sequence:CCGGTATCAAGCGTGGTCCGAAATGCTCGAGCATTTCGGACCACGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-574s21c1
Sequence:CCGGATTGAAGTTACCAGTAGATTTCTCGAGAAATCTACTGGTAACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144541.1-1129s1c1
Sequence:CCGGCAAGAGAGCAAAGGCTTATTTCTCGAGAAATAAGCCTTTGCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144541.1-1032s21c1
Sequence:CCGGTTCAGTCAGTCTATCACTTTACTCGAGTAAAGTGATAGACTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004899
BRE MISSION shRNA Bacterial Glycerol Stock
brain and reproductive organ-expressed (TNFRSF1A modulator)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-708s1c1
Sequence:CCGGGCCCGTAGATTTCAGCAATATCTCGAGATATTGCTGAAATCTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-484s1c1
Sequence:CCGGGCCTCCTGGAATCCTTCAAATCTCGAGATTTGAAGGATTCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-1074s1c1
Sequence:CCGGGCTGCTGATGTGGAAAGATTTCTCGAGAAATCTTTCCACATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-463s1c1
Sequence:CCGGCCCTCAGCTTTGCAGAATCTTCTCGAGAAGATTCTGCAAAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-831s1c1
Sequence:CCGGGCTGTACTTGTCACCTCGAATCTCGAGATTCGAGGTGACAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004899
BRE MISSION shRNA shRNA Plasmid DNA
brain and reproductive organ-expressed (TNFRSF1A modulator)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-708s1c1
Sequence:CCGGGCCCGTAGATTTCAGCAATATCTCGAGATATTGCTGAAATCTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-484s1c1
Sequence:CCGGGCCTCCTGGAATCCTTCAAATCTCGAGATTTGAAGGATTCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-1074s1c1
Sequence:CCGGGCTGCTGATGTGGAAAGATTTCTCGAGAAATCTTTCCACATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-463s1c1
Sequence:CCGGCCCTCAGCTTTGCAGAATCTTCTCGAGAAGATTCTGCAAAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-831s1c1
Sequence:CCGGGCTGTACTTGTCACCTCGAATCTCGAGATTCGAGGTGACAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004899
BRE MISSION shRNA Lentiviral Transduction Particles
brain and reproductive organ-expressed (TNFRSF1A modulator)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-708s1c1
Sequence:CCGGGCCCGTAGATTTCAGCAATATCTCGAGATATTGCTGAAATCTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-484s1c1
Sequence:CCGGGCCTCCTGGAATCCTTCAAATCTCGAGATTTGAAGGATTCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-1074s1c1
Sequence:CCGGGCTGCTGATGTGGAAAGATTTCTCGAGAAATCTTTCCACATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-463s1c1
Sequence:CCGGCCCTCAGCTTTGCAGAATCTTCTCGAGAAGATTCTGCAAAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004899.3-831s1c1
Sequence:CCGGGCTGTACTTGTCACCTCGAATCTCGAGATTCGAGGTGACAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks