EMAIL THIS PAGE TO A FRIEND

BREA2

42 Gene Product Result for
Species: Human BREA2(286076)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024610 Rosetta Predictions human pricing
XR_040172 Rosetta Predictions human pricing
XR_040173 Rosetta Predictions human pricing
XR_040174 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012934 predicted 268
2 SASI_Hs01_00012935 predicted 315
3 SASI_Hs01_00012936 predicted 359
4 SASI_Hs01_00012937 predicted 249
5 SASI_Hs01_00012938 predicted 317
6 SASI_Hs01_00012939 predicted 239
7 SASI_Hs01_00012940 predicted 300
8 SASI_Hs01_00012941 predicted 219
9 SASI_Hs01_00012942 predicted 543
10 SASI_Hs01_00012943 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516574 predicted 330
2 SASI_Hs02_00516575 predicted 210
3 SASI_Hs02_00516576 predicted 48
4 SASI_Hs02_00516577 predicted 277
5 SASI_Hs02_00516578 predicted 101
6 SASI_Hs02_00516579 predicted 213
7 SASI_Hs02_00516580 predicted 321
8 SASI_Hs02_00516581 predicted 318
9 SASI_Hs02_00516582 predicted 30
10 SASI_Hs02_00516583 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516584 predicted 328
2 SASI_Hs02_00516585 predicted 210
3 SASI_Hs02_00516586 predicted 55
4 SASI_Hs02_00516587 predicted 275
5 SASI_Hs02_00516588 predicted 102
6 SASI_Hs02_00516589 predicted 213
7 SASI_Hs02_00516590 predicted 316
8 SASI_Hs02_00516591 predicted 326
9 SASI_Hs02_00516592 predicted 24
10 SASI_Hs02_00516593 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516594 predicted 334
2 SASI_Hs02_00516595 predicted 55
3 SASI_Hs02_00516596 predicted 213
4 SASI_Hs02_00516597 predicted 273
5 SASI_Hs02_00516598 predicted 104
6 SASI_Hs02_00516599 predicted 319
7 SASI_Hs02_00516600 predicted 322
8 SASI_Hs02_00516601 predicted 23
9 SASI_Hs02_00516602 predicted 348
10 SASI_Hs02_00516603 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024610
BREA2 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024610.1-424s1c1
Sequence:CCGGCTGCTCTTAGCTGTCTTTCCTCTCGAGAGGAAAGACAGCTAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024610.1-827s1c1
Sequence:CCGGCAGCCTTGACTGAAAGATGAACTCGAGTTCATCTTTCAGTCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024610
BREA2 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024610.1-424s1c1
Sequence:CCGGCTGCTCTTAGCTGTCTTTCCTCTCGAGAGGAAAGACAGCTAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024610.1-827s1c1
Sequence:CCGGCAGCCTTGACTGAAAGATGAACTCGAGTTCATCTTTCAGTCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024610
BREA2 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024610.1-424s1c1
Sequence:CCGGCTGCTCTTAGCTGTCTTTCCTCTCGAGAGGAAAGACAGCTAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024610.1-827s1c1
Sequence:CCGGCAGCCTTGACTGAAAGATGAACTCGAGTTCATCTTTCAGTCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks