EMAIL THIS PAGE TO A FRIEND

BRF1

BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit

78 Gene Product Result for
Synonyms: BRF BRF-1 GTF3B TAF3B2 TAF3C TAFIII90 TF3B90 TFIIIB90 hBRF
Gene ID:
Human(2972) Summary: This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Mouse(72308) BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
Rat(299347) BRF1, RNA polymerase III transcription initiation factor 90 subunit
chicken(423503) BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
cow(618161) BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
domestic cat(101101064) BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
dog(490883) BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
naked mole-rat(101723395) BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
domestic guinea pig(100715760) BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
sheep(101106207) BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0108 AQUA Peptide INYSVL[R] cow, dog, human, mouse, rat pricing
AQ0054 AQUA Peptide EPIQASTA[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001519 Rosetta Predictions human pricing
NM_145685 Rosetta Predictions human pricing
NM_145696 Rosetta Predictions human pricing
NM_001106761 Rosetta Predictions rat pricing
NM_028193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131187 predicted 1792
2 SASI_Hs01_00131188 predicted 1176
3 SASI_Hs02_00332043 predicted 2762
4 SASI_Hs01_00131189 predicted 2599
5 SASI_Hs01_00131190 predicted 2549
6 SASI_Hs01_00131191 predicted 1501
7 SASI_Hs01_00131192 predicted 1170
8 SASI_Hs01_00131193 predicted 2028
9 SASI_Hs01_00131194 predicted 2590
10 SASI_Hs01_00131195 predicted 2683
11 SASI_Hs01_00131196 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220360 predicted 1705
2 SASI_Hs01_00220361 predicted 1087
3 SASI_Hs02_00365287 predicted 2667
4 SASI_Hs01_00220362 predicted 2506
5 SASI_Hs01_00220363 predicted 2452
6 SASI_Hs01_00220364 predicted 1402
7 SASI_Hs01_00220365 predicted 1084
8 SASI_Hs01_00220366 predicted 1937
9 SASI_Hs01_00220367 predicted 2496
10 SASI_Hs01_00220368 predicted 2589
11 SASI_Hs01_00220369 predicted 2266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182780 predicted 1442
2 SASI_Hs01_00182781 predicted 1434
3 SASI_Hs01_00182782 predicted 1456
4 SASI_Hs01_00182783 predicted 1459
5 SASI_Hs01_00182784 predicted 1562
6 SASI_Hs01_00182785 predicted 1600
7 SASI_Hs01_00182786 predicted 1811
8 SASI_Hs01_00182787 predicted 1633
9 SASI_Hs01_00182788 predicted 1639
10 SASI_Hs01_00182789 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222138 predicted 602
2 SASI_Rn02_00222139 predicted 1477
3 SASI_Rn02_00222140 predicted 1036
4 SASI_Rn02_00222141 predicted 453
5 SASI_Rn02_00222142 predicted 618
6 SASI_Rn02_00222143 predicted 1415
7 SASI_Rn02_00222144 predicted 823
8 SASI_Rn02_00222145 predicted 1925
9 SASI_Rn02_00222146 predicted 1015
10 SASI_Rn02_00222147 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136903 predicted 1673
2 SASI_Mm02_00333493 predicted 699
3 SASI_Mm01_00136905 predicted 1087
4 SASI_Mm01_00136908 predicted 680
5 SASI_Mm01_00136907 predicted 1623
6 SASI_Mm01_00136909 predicted 2116
7 SASI_Mm01_00136910 predicted 624
8 SASI_Mm01_00136911 predicted 791
9 SASI_Mm01_00136912 predicted 808
10 SASI_Mm02_00333494 predicted 1204
11 SASI_Mm01_00136904 predicted 1250
12 SASI_Mm01_00136906 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001519
BRF1 MISSION shRNA Bacterial Glycerol Stock
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001519.2-2554s1c1
Sequence:CCGGCCATTGGGATTGTGTTTCTATCTCGAGATAGAAACACAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-832s1c1
Sequence:CCGGCAGGTGAATGTGTACGTGCTTCTCGAGAAGCACGTACACATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-913s1c1
Sequence:CCGGTGCCTGTATATTCCACGCTTTCTCGAGAAAGCGTGGAATATACAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1278s1c1
Sequence:CCGGGCTTGAACAAGTCCTGTCAAACTCGAGTTTGACAGGACTTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1857s1c1
Sequence:CCGGCGGCATCTACAAGGAACACAACTCGAGTTGTGTTCCTTGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1733s21c1
Sequence:CCGGTTGACAGGTACATCCTGAATGCTCGAGCATTCAGGATGTACCTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-2345s21c1
Sequence:CCGGTGATGGGCAGCAACGACTATGCTCGAGCATAGTCGTTGCTGCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1306s21c1
Sequence:CCGGGAGGAGGTTGAAGGTGAAATACTCGAGTATTTCACCTTCAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1328s21c1
Sequence:CCGGCCAGTTACCAGGATGCAATTGCTCGAGCAATTGCATCCTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001519
BRF1 MISSION shRNA shRNA Plasmid DNA
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001519.2-2554s1c1
Sequence:CCGGCCATTGGGATTGTGTTTCTATCTCGAGATAGAAACACAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-832s1c1
Sequence:CCGGCAGGTGAATGTGTACGTGCTTCTCGAGAAGCACGTACACATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-913s1c1
Sequence:CCGGTGCCTGTATATTCCACGCTTTCTCGAGAAAGCGTGGAATATACAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1278s1c1
Sequence:CCGGGCTTGAACAAGTCCTGTCAAACTCGAGTTTGACAGGACTTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1857s1c1
Sequence:CCGGCGGCATCTACAAGGAACACAACTCGAGTTGTGTTCCTTGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1733s21c1
Sequence:CCGGTTGACAGGTACATCCTGAATGCTCGAGCATTCAGGATGTACCTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-2345s21c1
Sequence:CCGGTGATGGGCAGCAACGACTATGCTCGAGCATAGTCGTTGCTGCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1306s21c1
Sequence:CCGGGAGGAGGTTGAAGGTGAAATACTCGAGTATTTCACCTTCAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1328s21c1
Sequence:CCGGCCAGTTACCAGGATGCAATTGCTCGAGCAATTGCATCCTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001519
BRF1 MISSION shRNA Lentiviral Transduction Particles
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001519.2-2554s1c1
Sequence:CCGGCCATTGGGATTGTGTTTCTATCTCGAGATAGAAACACAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-832s1c1
Sequence:CCGGCAGGTGAATGTGTACGTGCTTCTCGAGAAGCACGTACACATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-913s1c1
Sequence:CCGGTGCCTGTATATTCCACGCTTTCTCGAGAAAGCGTGGAATATACAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1278s1c1
Sequence:CCGGGCTTGAACAAGTCCTGTCAAACTCGAGTTTGACAGGACTTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001519.2-1857s1c1
Sequence:CCGGCGGCATCTACAAGGAACACAACTCGAGTTGTGTTCCTTGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1733s21c1
Sequence:CCGGTTGACAGGTACATCCTGAATGCTCGAGCATTCAGGATGTACCTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-2345s21c1
Sequence:CCGGTGATGGGCAGCAACGACTATGCTCGAGCATAGTCGTTGCTGCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1306s21c1
Sequence:CCGGGAGGAGGTTGAAGGTGAAATACTCGAGTATTTCACCTTCAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001519.2-1328s21c1
Sequence:CCGGCCAGTTACCAGGATGCAATTGCTCGAGCAATTGCATCCTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028193
VALIDATED
BRF1 MISSION shRNA Bacterial Glycerol Stock
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-2376s1c1
Sequence:CCGGCCACGGCTCATAGGAATGATTCTCGAGAATCATTCCTATGAGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1076s1c1
Sequence:CCGGCCAACCAGTCAGCTCACTATTCTCGAGAATAGTGAGCTGACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1624s1c1
Sequence:CCGGCCTTGAGATTGACAGATACATCTCGAGATGTATCTGTCAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-582s1c1
Sequence:CCGGGCCTGGACACAGCATTCAATTCTCGAGAATTGAATGCTGTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-1244s1c1
Sequence:CCGGGCCATTGAAATTGAGCTAGAACTCGAGTTCTAGCTCAATTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028193
VALIDATED
BRF1 MISSION shRNA shRNA Plasmid DNA
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-2376s1c1
Sequence:CCGGCCACGGCTCATAGGAATGATTCTCGAGAATCATTCCTATGAGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1076s1c1
Sequence:CCGGCCAACCAGTCAGCTCACTATTCTCGAGAATAGTGAGCTGACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1624s1c1
Sequence:CCGGCCTTGAGATTGACAGATACATCTCGAGATGTATCTGTCAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-582s1c1
Sequence:CCGGGCCTGGACACAGCATTCAATTCTCGAGAATTGAATGCTGTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-1244s1c1
Sequence:CCGGGCCATTGAAATTGAGCTAGAACTCGAGTTCTAGCTCAATTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028193
VALIDATED
BRF1 MISSION shRNA Lentiviral Transduction Particles
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-2376s1c1
Sequence:CCGGCCACGGCTCATAGGAATGATTCTCGAGAATCATTCCTATGAGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1076s1c1
Sequence:CCGGCCAACCAGTCAGCTCACTATTCTCGAGAATAGTGAGCTGACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-1624s1c1
Sequence:CCGGCCTTGAGATTGACAGATACATCTCGAGATGTATCTGTCAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028193.2-582s1c1
Sequence:CCGGGCCTGGACACAGCATTCAATTCTCGAGAATTGAATGCTGTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028193.2-1244s1c1
Sequence:CCGGGCCATTGAAATTGAGCTAGAACTCGAGTTCTAGCTCAATTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks