EMAIL THIS PAGE TO A FRIEND

BRF2

BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit

71 Gene Product Result for
Synonyms: BRFU TFIIIB50
UniProtKB ID: Q9HAW0, B2RD62, D3DSW6, Q9H2Y3, Q9H3B3, Q9NUY6
Gene ID:
Human(55290) Summary: This gene encodes one of the multiple subunits of the RNA polymerase III transcription factor complex required for transcription of genes with promoter elements upstream of the initiation site. The product of this gene, a TFIIB-like factor, is directly recruited to the TATA-box of polymerase III small nuclear RNA gene promoters through its interaction with the TATA-binding protein. [provided by RefSeq, Jul 2008]
Mouse(66653) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
Rat(306542) BRF2, RNA polymerase III transcription initiation factor 50 subunit
Zebrafish(445142) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
cow(512789) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
domestic cat(101088834) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
dog(608026) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
chicken(426772) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
sheep(101110733) BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
domestic guinea pig(100733747) BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
naked mole-rat(101713510) BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018310 Rosetta Predictions human pricing
NM_001024773 Rosetta Predictions rat pricing
NM_025686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020921 predicted 1119
2 SASI_Hs01_00020922 predicted 946
3 SASI_Hs01_00020923 predicted 1392
4 SASI_Hs01_00020924 predicted 262
5 SASI_Hs01_00020925 predicted 218
6 SASI_Hs01_00020926 predicted 694
7 SASI_Hs01_00020927 predicted 633
8 SASI_Hs01_00020928 predicted 1264
9 SASI_Hs01_00020929 predicted 1372
10 SASI_Hs02_00351722 predicted 620
11 SASI_Hs01_00020920 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079885 predicted 284
2 SASI_Rn01_00079886 predicted 653
3 SASI_Rn01_00079887 predicted 1365
4 SASI_Rn01_00079888 predicted 362
5 SASI_Rn01_00079889 predicted 906
6 SASI_Rn02_00202663 predicted 946
7 SASI_Rn01_00079891 predicted 1248
8 SASI_Rn01_00079892 predicted 517
9 SASI_Rn01_00079893 predicted 1075
10 SASI_Rn01_00079894 predicted 1210
11 SASI_Rn01_00079890 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182881 predicted 472
2 SASI_Mm01_00182882 predicted 649
3 SASI_Mm01_00182883 predicted 507
4 SASI_Mm01_00182884 predicted 404
5 SASI_Mm01_00182885 predicted 201
6 SASI_Mm01_00182886 predicted 505
7 SASI_Mm01_00182887 predicted 281
8 SASI_Mm01_00182888 predicted 306
9 SASI_Mm01_00182889 predicted 258
10 SASI_Mm01_00182890 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025686
VALIDATED
BRF2 MISSION shRNA Bacterial Glycerol Stock
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-428s21c1
Sequence:CCGGATCACCTGTCGGCAACATAACCTCGAGGTTATGTTGCCGACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-268s21c1
Sequence:CCGGACGAGATCTCCGTCGAGTAAGCTCGAGCTTACTCGACGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-898s21c1
Sequence:CCGGGGCCTGGCTACAGGTTCTAAACTCGAGTTTAGAACCTGTAGCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-511s1c1
Sequence:CCGGGCACCTACATGCAGATGGTAACTCGAGTTACCATCTGCATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-101s1c1
Sequence:CCGGGCTCGTGGAAGATTCGCATTACTCGAGTAATGCGAATCTTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-1218s1c1
Sequence:CCGGGATAGTGAAATAGAGCAGTATCTCGAGATACTGCTCTATTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-659s1c1
Sequence:CCGGGCTGTCTCGAACCTTGCTGTTCTCGAGAACAGCAAGGTTCGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-1201s1c1
Sequence:CCGGGCGATGAGGATATTTCAGATACTCGAGTATCTGAAATATCCTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025686
VALIDATED
BRF2 MISSION shRNA shRNA Plasmid DNA
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-428s21c1
Sequence:CCGGATCACCTGTCGGCAACATAACCTCGAGGTTATGTTGCCGACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-268s21c1
Sequence:CCGGACGAGATCTCCGTCGAGTAAGCTCGAGCTTACTCGACGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-898s21c1
Sequence:CCGGGGCCTGGCTACAGGTTCTAAACTCGAGTTTAGAACCTGTAGCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-511s1c1
Sequence:CCGGGCACCTACATGCAGATGGTAACTCGAGTTACCATCTGCATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-101s1c1
Sequence:CCGGGCTCGTGGAAGATTCGCATTACTCGAGTAATGCGAATCTTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-1218s1c1
Sequence:CCGGGATAGTGAAATAGAGCAGTATCTCGAGATACTGCTCTATTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-659s1c1
Sequence:CCGGGCTGTCTCGAACCTTGCTGTTCTCGAGAACAGCAAGGTTCGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-1201s1c1
Sequence:CCGGGCGATGAGGATATTTCAGATACTCGAGTATCTGAAATATCCTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025686
VALIDATED
BRF2 MISSION shRNA Lentiviral Transduction Particles
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-428s21c1
Sequence:CCGGATCACCTGTCGGCAACATAACCTCGAGGTTATGTTGCCGACAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-268s21c1
Sequence:CCGGACGAGATCTCCGTCGAGTAAGCTCGAGCTTACTCGACGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025686.2-898s21c1
Sequence:CCGGGGCCTGGCTACAGGTTCTAAACTCGAGTTTAGAACCTGTAGCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-511s1c1
Sequence:CCGGGCACCTACATGCAGATGGTAACTCGAGTTACCATCTGCATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-101s1c1
Sequence:CCGGGCTCGTGGAAGATTCGCATTACTCGAGTAATGCGAATCTTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025686.1-1218s1c1
Sequence:CCGGGATAGTGAAATAGAGCAGTATCTCGAGATACTGCTCTATTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-659s1c1
Sequence:CCGGGCTGTCTCGAACCTTGCTGTTCTCGAGAACAGCAAGGTTCGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025686.1-1201s1c1
Sequence:CCGGGCGATGAGGATATTTCAGATACTCGAGTATCTGAAATATCCTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018310
VALIDATED
BRF2 MISSION shRNA Bacterial Glycerol Stock
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-783s21c1
Sequence:CCGGGTCATCACTGCTGCGACTTTCCTCGAGGAAAGTCGCAGCAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-154s21c1
Sequence:CCGGTGGTGGAAGACTCGCACTATTCTCGAGAATAGTGCGAGTCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-840s21c1
Sequence:CCGGTCATGTTCCCTTGCCCGATTTCTCGAGAAATCGGGCAAGGGAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018310.2-1535s21c1
Sequence:CCGGAGGAGTGCAGGGATGACTATACTCGAGTATAGTCATCCCTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-460s21c1
Sequence:CCGGTGGTTGGGTGCTGCGTCTTAACTCGAGTTAAGACGCAGCACCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018310.2-681s1c1
Sequence:CCGGGCCAAATACGTGGAAGACAAACTCGAGTTTGTCTTCCACGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018310.2-1296s1c1
Sequence:CCGGCCTCAGGAAGTTAGGGACTTTCTCGAGAAAGTCCCTAACTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-262s1c1
Sequence:CCGGGAGAGGTAACATATTCCCGAACTCGAGTTCGGGAATATGTTACCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-710s1c1
Sequence:CCGGGCTGTCTCGAACAATGCAGTTCTCGAGAACTGCATTGTTCGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-526s1c1
Sequence:CCGGGCACGCTGTTGTATGCAGATTCTCGAGAATCTGCATACAACAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018310
VALIDATED
BRF2 MISSION shRNA shRNA Plasmid DNA
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-783s21c1
Sequence:CCGGGTCATCACTGCTGCGACTTTCCTCGAGGAAAGTCGCAGCAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-154s21c1
Sequence:CCGGTGGTGGAAGACTCGCACTATTCTCGAGAATAGTGCGAGTCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-840s21c1
Sequence:CCGGTCATGTTCCCTTGCCCGATTTCTCGAGAAATCGGGCAAGGGAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018310.2-1535s21c1
Sequence:CCGGAGGAGTGCAGGGATGACTATACTCGAGTATAGTCATCCCTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-460s21c1
Sequence:CCGGTGGTTGGGTGCTGCGTCTTAACTCGAGTTAAGACGCAGCACCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018310.2-681s1c1
Sequence:CCGGGCCAAATACGTGGAAGACAAACTCGAGTTTGTCTTCCACGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018310.2-1296s1c1
Sequence:CCGGCCTCAGGAAGTTAGGGACTTTCTCGAGAAAGTCCCTAACTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-262s1c1
Sequence:CCGGGAGAGGTAACATATTCCCGAACTCGAGTTCGGGAATATGTTACCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-710s1c1
Sequence:CCGGGCTGTCTCGAACAATGCAGTTCTCGAGAACTGCATTGTTCGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-526s1c1
Sequence:CCGGGCACGCTGTTGTATGCAGATTCTCGAGAATCTGCATACAACAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018310
VALIDATED
BRF2 MISSION shRNA Lentiviral Transduction Particles
BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-783s21c1
Sequence:CCGGGTCATCACTGCTGCGACTTTCCTCGAGGAAAGTCGCAGCAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-154s21c1
Sequence:CCGGTGGTGGAAGACTCGCACTATTCTCGAGAATAGTGCGAGTCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-840s21c1
Sequence:CCGGTCATGTTCCCTTGCCCGATTTCTCGAGAAATCGGGCAAGGGAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018310.2-1535s21c1
Sequence:CCGGAGGAGTGCAGGGATGACTATACTCGAGTATAGTCATCCCTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018310.2-460s21c1
Sequence:CCGGTGGTTGGGTGCTGCGTCTTAACTCGAGTTAAGACGCAGCACCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_018310.2-681s1c1
Sequence:CCGGGCCAAATACGTGGAAGACAAACTCGAGTTTGTCTTCCACGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018310.2-1296s1c1
Sequence:CCGGCCTCAGGAAGTTAGGGACTTTCTCGAGAAAGTCCCTAACTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-262s1c1
Sequence:CCGGGAGAGGTAACATATTCCCGAACTCGAGTTCGGGAATATGTTACCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-710s1c1
Sequence:CCGGGCTGTCTCGAACAATGCAGTTCTCGAGAACTGCATTGTTCGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018310.2-526s1c1
Sequence:CCGGGCACGCTGTTGTATGCAGATTCTCGAGAATCTGCATACAACAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks