EMAIL THIS PAGE TO A FRIEND

BRI3

brain protein I3

57 Gene Product Result for
Synonyms: I3
UniProtKB ID: O95415, D6W5R8, Q8WV52, Q9UIC6
Gene ID:
Mouse(55950) brain protein I3
Rat(304284) brain protein I3
Zebrafish(100002236) brain protein I3
cow(615390) brain protein I3
domestic cat(101082113) brain protein I3
dog(608902) brain protein I3
sheep(101104367) brain protein I3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015379 Rosetta Predictions human pricing
NM_001009604 Rosetta Predictions rat pricing
XM_001071637 Rosetta Predictions rat pricing
NM_018772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069794 predicted 470
2 SASI_Hs01_00069795 predicted 476
3 SASI_Hs01_00069796 predicted 473
4 SASI_Hs01_00069798 predicted 541
5 SASI_Hs01_00069799 predicted 548
6 SASI_Hs01_00069800 predicted 543
7 SASI_Hs01_00069801 predicted 478
8 SASI_Hs01_00069802 predicted 507
9 SASI_Hs02_00347728 predicted 480
10 SASI_Hs02_00347729 predicted 545
11 SASI_Hs01_00069797 predicted 506
12 SASI_Hs01_00069803 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097056 predicted 287
2 SASI_Rn01_00097057 predicted 332
3 SASI_Rn01_00097060 predicted 339
4 SASI_Rn01_00097061 predicted 292
5 SASI_Rn01_00097062 predicted 264
6 SASI_Rn01_00097063 predicted 289
7 SASI_Rn01_00097064 predicted 341
8 SASI_Rn02_00199614 predicted 275
9 SASI_Rn02_00199615 predicted 460
10 SASI_Rn02_00199616 predicted 518
11 SASI_Rn01_00097058 predicted 376
12 SASI_Rn01_00097059 predicted 297
13 SASI_Rn01_00097065 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335825 predicted 268
2 SASI_Rn02_00335826 predicted 262
3 SASI_Rn02_00335827 predicted 501
4 SASI_Rn02_00335828 predicted 458
5 SASI_Rn02_00335829 predicted 256
6 SASI_Rn02_00335830 predicted 262
7 SASI_Rn02_00335831 predicted 456
8 SASI_Rn02_00335832 predicted 250
9 SASI_Rn02_00335833 predicted 526
10 SASI_Rn02_00335834 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195095 predicted 690
2 SASI_Mm02_00324084 predicted 710
3 SASI_Mm01_00195096 predicted 501
4 SASI_Mm01_00195097 predicted 403
5 SASI_Mm01_00195098 predicted 723
6 SASI_Mm01_00195099 predicted 685
7 SASI_Mm01_00195100 predicted 560
8 SASI_Mm01_00195101 predicted 487
9 SASI_Mm01_00195102 predicted 506
10 SASI_Mm01_00195103 predicted 429
11 SASI_Mm01_00195104 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015379
VALIDATED
BRI3 MISSION shRNA Bacterial Glycerol Stock
brain protein I3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000005342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-285s1c1
Sequence:CCGGGCCAACTCTATCGTGGTCGTACTCGAGTACGACCACGATAGAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-219s1c1
Sequence:CCGGACAGGGATACCCACCCACCATCTCGAGATGGTGGGTGGGTATCCCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-274s1c1
Sequence:CCGGCCCGCTATCCTGCCAACTCTACTCGAGTAGAGTTGGCAGGATAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015379.1-437s1c1
Sequence:CCGGCTGTGGAGCCACCTTCGCTTACTCGAGTAAGCGAAGGTGGCTCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015379
VALIDATED
BRI3 MISSION shRNA shRNA Plasmid DNA
brain protein I3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000005342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-285s1c1
Sequence:CCGGGCCAACTCTATCGTGGTCGTACTCGAGTACGACCACGATAGAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-219s1c1
Sequence:CCGGACAGGGATACCCACCCACCATCTCGAGATGGTGGGTGGGTATCCCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-274s1c1
Sequence:CCGGCCCGCTATCCTGCCAACTCTACTCGAGTAGAGTTGGCAGGATAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015379.1-437s1c1
Sequence:CCGGCTGTGGAGCCACCTTCGCTTACTCGAGTAAGCGAAGGTGGCTCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015379
VALIDATED
BRI3 MISSION shRNA Lentiviral Transduction Particles
brain protein I3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000005342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-285s1c1
Sequence:CCGGGCCAACTCTATCGTGGTCGTACTCGAGTACGACCACGATAGAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-219s1c1
Sequence:CCGGACAGGGATACCCACCCACCATCTCGAGATGGTGGGTGGGTATCCCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015379.1-274s1c1
Sequence:CCGGCCCGCTATCCTGCCAACTCTACTCGAGTAGAGTTGGCAGGATAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015379.1-437s1c1
Sequence:CCGGCTGTGGAGCCACCTTCGCTTACTCGAGTAAGCGAAGGTGGCTCCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018772
VALIDATED
BRI3 MISSION shRNA Bacterial Glycerol Stock
brain protein I3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-469s1c1
Sequence:CCGGGCTTTGCACTGTGGAAGCGAACTCGAGTTCGCTTCCACAGTGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018772.2-496s1c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018772.2-769s1c1
Sequence:CCGGCATACCATTGTGTAGCTTGTTCTCGAGAACAAGCTACACAATGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-306s1c1
Sequence:CCGGCGGGTCTATAACATCCACAGTCTCGAGACTGTGGATGTTATAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-310s1c1
Sequence:CCGGTCTATAACATCCACAGTCGAACTCGAGTTCGACTGTGGATGTTATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.4-736s21c1
Sequence:CCGGACTTTGAGAATGGTGAGAAATCTCGAGATTTCTCACCATTCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-351s21c1
Sequence:CCGGGTATCCTGCCAACTCCATCGTCTCGAGACGATGGAGTTGGCAGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.3-691s21c1
Sequence:CCGGGGGTAACGTGCTGCTTCTATTCTCGAGAATAGAAGCAGCACGTTACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-390s21c1
Sequence:CCGGTTGGTGTCCTGGAGTACTGCTCTCGAGAGCAGTACTCCAGGACACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-317s21c1
Sequence:CCGGGGGTCTATAACATCCACAGTCCTCGAGGACTGTGGATGTTATAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-303s21c1
Sequence:CCGGCCCGGGTCTATAACATCCACACTCGAGTGTGGATGTTATAGACCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-471s21c1
Sequence:CCGGTTGCACTGTGGAAGCGAAGATCTCGAGATCTTCGCTTCCACAGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-495s21c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-482s21c1
Sequence:CCGGTTGCACTGAGGAAGCGAAGATCTCGAGATCTTCGCTTCCTCAGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018772
VALIDATED
BRI3 MISSION shRNA shRNA Plasmid DNA
brain protein I3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-469s1c1
Sequence:CCGGGCTTTGCACTGTGGAAGCGAACTCGAGTTCGCTTCCACAGTGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018772.2-496s1c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018772.2-769s1c1
Sequence:CCGGCATACCATTGTGTAGCTTGTTCTCGAGAACAAGCTACACAATGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-306s1c1
Sequence:CCGGCGGGTCTATAACATCCACAGTCTCGAGACTGTGGATGTTATAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-310s1c1
Sequence:CCGGTCTATAACATCCACAGTCGAACTCGAGTTCGACTGTGGATGTTATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.4-736s21c1
Sequence:CCGGACTTTGAGAATGGTGAGAAATCTCGAGATTTCTCACCATTCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-351s21c1
Sequence:CCGGGTATCCTGCCAACTCCATCGTCTCGAGACGATGGAGTTGGCAGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.3-691s21c1
Sequence:CCGGGGGTAACGTGCTGCTTCTATTCTCGAGAATAGAAGCAGCACGTTACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-390s21c1
Sequence:CCGGTTGGTGTCCTGGAGTACTGCTCTCGAGAGCAGTACTCCAGGACACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-317s21c1
Sequence:CCGGGGGTCTATAACATCCACAGTCCTCGAGGACTGTGGATGTTATAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-303s21c1
Sequence:CCGGCCCGGGTCTATAACATCCACACTCGAGTGTGGATGTTATAGACCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-471s21c1
Sequence:CCGGTTGCACTGTGGAAGCGAAGATCTCGAGATCTTCGCTTCCACAGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-495s21c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-482s21c1
Sequence:CCGGTTGCACTGAGGAAGCGAAGATCTCGAGATCTTCGCTTCCTCAGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018772
VALIDATED
BRI3 MISSION shRNA Lentiviral Transduction Particles
brain protein I3
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-469s1c1
Sequence:CCGGGCTTTGCACTGTGGAAGCGAACTCGAGTTCGCTTCCACAGTGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018772.2-496s1c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018772.2-769s1c1
Sequence:CCGGCATACCATTGTGTAGCTTGTTCTCGAGAACAAGCTACACAATGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-306s1c1
Sequence:CCGGCGGGTCTATAACATCCACAGTCTCGAGACTGTGGATGTTATAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018772.2-310s1c1
Sequence:CCGGTCTATAACATCCACAGTCGAACTCGAGTTCGACTGTGGATGTTATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.4-736s21c1
Sequence:CCGGACTTTGAGAATGGTGAGAAATCTCGAGATTTCTCACCATTCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-351s21c1
Sequence:CCGGGTATCCTGCCAACTCCATCGTCTCGAGACGATGGAGTTGGCAGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018772.3-691s21c1
Sequence:CCGGGGGTAACGTGCTGCTTCTATTCTCGAGAATAGAAGCAGCACGTTACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-390s21c1
Sequence:CCGGTTGGTGTCCTGGAGTACTGCTCTCGAGAGCAGTACTCCAGGACACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-317s21c1
Sequence:CCGGGGGTCTATAACATCCACAGTCCTCGAGGACTGTGGATGTTATAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-303s21c1
Sequence:CCGGCCCGGGTCTATAACATCCACACTCGAGTGTGGATGTTATAGACCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-471s21c1
Sequence:CCGGTTGCACTGTGGAAGCGAAGATCTCGAGATCTTCGCTTCCACAGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.3-495s21c1
Sequence:CCGGCCAACTGTGGAGCGGTCTTTACTCGAGTAAAGACCGCTCCACAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018772.4-482s21c1
Sequence:CCGGTTGCACTGAGGAAGCGAAGATCTCGAGATCTTCGCTTCCTCAGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)