EMAIL THIS PAGE TO A FRIEND

BRICD5

BRICHOS domain containing 5

42 Gene Product Result for
Synonyms: C16orf79
UniProtKB ID: Q6PL45, C9J7K2, Q8IXU9
Gene ID:
Mouse(319259) BRICHOS domain containing 5
Rat(681370) BRICHOS domain containing 5
Zebrafish(792755) BRICHOS domain containing 5
cow(100139898) BRICHOS domain containing 5
domestic cat(101082201) BRICHOS domain containing 5
dog(610930) BRICHOS domain containing 5
naked mole-rat(101711196) BRICHOS domain containing 5
domestic guinea pig(100733454) BRICHOS domain containing 5
sheep(101114923) BRICHOS domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182563 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042971 MISSION® esiRNA esiRNA human C16orf79 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182563 Rosetta Predictions human pricing
XM_001061456 Rosetta Predictions rat pricing
NM_175682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019732 predicted 503
2 SASI_Hs01_00019733 predicted 500
3 SASI_Hs01_00019734 predicted 737
4 SASI_Hs01_00019735 predicted 497
5 SASI_Hs01_00019736 predicted 589
6 SASI_Hs01_00019737 predicted 509
7 SASI_Hs01_00019738 predicted 566
8 SASI_Hs01_00019739 predicted 513
9 SASI_Hs01_00019740 predicted 496
10 SASI_Hs02_00370693 predicted 528
11 SASI_Hs01_00019741 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300154 predicted 1400
2 SASI_Rn02_00300155 predicted 1376
3 SASI_Rn02_00300156 predicted 1419
4 SASI_Rn02_00300157 predicted 1427
5 SASI_Rn02_00300158 predicted 1401
6 SASI_Rn02_00300159 predicted 1303
7 SASI_Rn02_00300160 predicted 1251
8 SASI_Rn02_00300161 predicted 1237
9 SASI_Rn02_00300162 predicted 1371
10 SASI_Rn02_00300163 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110887 predicted 731
2 SASI_Mm01_00110888 predicted 394
3 SASI_Mm01_00110890 predicted 632
4 SASI_Mm01_00110891 predicted 441
5 SASI_Mm01_00110892 predicted 623
6 SASI_Mm01_00110893 predicted 445
7 SASI_Mm01_00110894 predicted 406
8 SASI_Mm01_00110895 predicted 462
9 SASI_Mm01_00110896 predicted 459
10 SASI_Mm02_00346615 predicted 737
11 SASI_Mm01_00110889 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175682
BRICD5 MISSION shRNA Bacterial Glycerol Stock
BRICHOS domain containing 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-824s1c1
Sequence:CCGGCATCTGTGTGTCTGTCTGCTTCTCGAGAAGCAGACAGACACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-711s1c1
Sequence:CCGGGTTTCAGTGCAACACCTTTGTCTCGAGACAAAGGTGTTGCACTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-709s1c1
Sequence:CCGGGAGTTTCAGTGCAACACCTTTCTCGAGAAAGGTGTTGCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-788s1c1
Sequence:CCGGGATCTACCTCTGCATTGACATCTCGAGATGTCAATGCAGAGGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175682
BRICD5 MISSION shRNA shRNA Plasmid DNA
BRICHOS domain containing 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-824s1c1
Sequence:CCGGCATCTGTGTGTCTGTCTGCTTCTCGAGAAGCAGACAGACACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-711s1c1
Sequence:CCGGGTTTCAGTGCAACACCTTTGTCTCGAGACAAAGGTGTTGCACTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-709s1c1
Sequence:CCGGGAGTTTCAGTGCAACACCTTTCTCGAGAAAGGTGTTGCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-788s1c1
Sequence:CCGGGATCTACCTCTGCATTGACATCTCGAGATGTCAATGCAGAGGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175682
BRICD5 MISSION shRNA Lentiviral Transduction Particles
BRICHOS domain containing 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-824s1c1
Sequence:CCGGCATCTGTGTGTCTGTCTGCTTCTCGAGAAGCAGACAGACACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-711s1c1
Sequence:CCGGGTTTCAGTGCAACACCTTTGTCTCGAGACAAAGGTGTTGCACTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-709s1c1
Sequence:CCGGGAGTTTCAGTGCAACACCTTTCTCGAGAAAGGTGTTGCACTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175682.2-788s1c1
Sequence:CCGGGATCTACCTCTGCATTGACATCTCGAGATGTCAATGCAGAGGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182563
BRICD5 MISSION shRNA Bacterial Glycerol Stock
BRICHOS domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-826s21c1
Sequence:CCGGATCTGCGTGTCGGTCTGCTTTCTCGAGAAAGCAGACCGACACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-806s21c1
Sequence:CCGGACATCTGCTTCCCGAGCAACACTCGAGTGTTGCTCGGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-603s21c1
Sequence:CCGGGGATACCTCCAAGGTCCAAGACTCGAGTCTTGGACCTTGGAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-508s21c1
Sequence:CCGGCAGAGCGGCTGCATCTGTTACCTCGAGGTAACAGATGCAGCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-775s21c1
Sequence:CCGGCGGAGACAGCGGCTGATTTATCTCGAGATAAATCAGCCGCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-791s21c1
Sequence:CCGGTTTATCTCTGCATCGACATCTCTCGAGAGATGTCGATGCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-517s21c1
Sequence:CCGGTGCATCTGTTACCGCCCTGAGCTCGAGCTCAGGGCGGTAACAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-783s21c1
Sequence:CCGGGCGGCTGATTTATCTCTGCATCTCGAGATGCAGAGATAAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182563
BRICD5 MISSION shRNA shRNA Plasmid DNA
BRICHOS domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-826s21c1
Sequence:CCGGATCTGCGTGTCGGTCTGCTTTCTCGAGAAAGCAGACCGACACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-806s21c1
Sequence:CCGGACATCTGCTTCCCGAGCAACACTCGAGTGTTGCTCGGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-603s21c1
Sequence:CCGGGGATACCTCCAAGGTCCAAGACTCGAGTCTTGGACCTTGGAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-508s21c1
Sequence:CCGGCAGAGCGGCTGCATCTGTTACCTCGAGGTAACAGATGCAGCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-775s21c1
Sequence:CCGGCGGAGACAGCGGCTGATTTATCTCGAGATAAATCAGCCGCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-791s21c1
Sequence:CCGGTTTATCTCTGCATCGACATCTCTCGAGAGATGTCGATGCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-517s21c1
Sequence:CCGGTGCATCTGTTACCGCCCTGAGCTCGAGCTCAGGGCGGTAACAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-783s21c1
Sequence:CCGGGCGGCTGATTTATCTCTGCATCTCGAGATGCAGAGATAAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182563
BRICD5 MISSION shRNA Lentiviral Transduction Particles
BRICHOS domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-826s21c1
Sequence:CCGGATCTGCGTGTCGGTCTGCTTTCTCGAGAAAGCAGACCGACACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-806s21c1
Sequence:CCGGACATCTGCTTCCCGAGCAACACTCGAGTGTTGCTCGGGAAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-603s21c1
Sequence:CCGGGGATACCTCCAAGGTCCAAGACTCGAGTCTTGGACCTTGGAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-508s21c1
Sequence:CCGGCAGAGCGGCTGCATCTGTTACCTCGAGGTAACAGATGCAGCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-775s21c1
Sequence:CCGGCGGAGACAGCGGCTGATTTATCTCGAGATAAATCAGCCGCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-791s21c1
Sequence:CCGGTTTATCTCTGCATCGACATCTCTCGAGAGATGTCGATGCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-517s21c1
Sequence:CCGGTGCATCTGTTACCGCCCTGAGCTCGAGCTCAGGGCGGTAACAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182563.2-783s21c1
Sequence:CCGGGCGGCTGATTTATCTCTGCATCTCGAGATGCAGAGATAAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks