EMAIL THIS PAGE TO A FRIEND

BRINP1

bone morphogenetic protein/retinoic acid inducible neural-specific 1

49 Gene Product Result for
Synonyms: DBC1 DBCCR1 FAM5A
Gene ID:
Human(1620) Summary: This gene is located within a chromosomal region that shows loss of heterozygosity in some bladder cancers. It contains a 5' CpG island that may be a frequent target of hypermethylation, and it may undergo hypermethylation-based silencing in some bladder cancers. [provided by RefSeq, Jul 2008]
Mouse(56710) bone morphogenic protein/retinoic acid inducible neural specific 1
Rat(140610) bone morphogenetic protein/retinoic acid inducible neural-specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014618 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064321 MISSION® esiRNA esiRNA targeting mouse Dbc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014618 Rosetta Predictions human pricing
NM_080482 Rosetta Predictions rat pricing
NM_019967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026198 predicted 2208
2 SASI_Hs01_00026200 predicted 564
3 SASI_Hs01_00026202 predicted 1143
4 SASI_Hs01_00026199 predicted 1069
5 SASI_Hs01_00026203 predicted 2323
6 SASI_Hs01_00026204 predicted 1328
7 SASI_Hs01_00026205 predicted 2509
8 SASI_Hs02_00345912 predicted 1734
9 SASI_Hs01_00026206 predicted 1024
10 SASI_Hs02_00345913 predicted 2424
11 SASI_Hs01_00026197 predicted 2392
12 SASI_Hs01_00026201 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104516 predicted 211
2 SASI_Rn01_00104517 predicted 2033
3 SASI_Rn01_00104518 predicted 1553
4 SASI_Rn01_00104519 predicted 2021
5 SASI_Rn01_00104520 predicted 1404
6 SASI_Rn01_00104521 predicted 1265
7 SASI_Rn01_00104522 predicted 623
8 SASI_Rn01_00104523 predicted 1471
9 SASI_Rn01_00104524 predicted 557
10 SASI_Rn01_00104525 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102535 predicted 1955
2 SASI_Mm01_00102536 predicted 538
3 SASI_Mm01_00102537 predicted 2194
4 SASI_Mm01_00102539 predicted 1286
5 SASI_Mm01_00102540 predicted 1046
6 SASI_Mm02_00325268 predicted 537
7 SASI_Mm01_00102541 predicted 2275
8 SASI_Mm01_00102543 predicted 938
9 SASI_Mm01_00102544 predicted 1340
10 SASI_Mm02_00325269 predicted 1198
11 SASI_Mm01_00102538 predicted 2489
12 SASI_Mm01_00102542 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019967
BRINP1 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-2912s21c1
Sequence:CCGGACGTGTTCTAGCGACTGTATACTCGAGTATACAGTCGCTAGAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-1786s21c1
Sequence:CCGGATAAGGGCTACAAGCTGTATACTCGAGTATACAGCTTGTAGCCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-541s21c1
Sequence:CCGGAGGAATTTGATTGGCTTATTTCTCGAGAAATAAGCCAATCAAATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-3172s21c1
Sequence:CCGGGAGGAAATGGACGTAGATAAACTCGAGTTTATCTACGTCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1520s1c1
Sequence:CCGGGCAATGAGATTCGCCTGGATACTCGAGTATCCAGGCGAATCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1278s1c1
Sequence:CCGGCCCATGTATCATAGGTGGGAACTCGAGTTCCCACCTATGATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-186s1c1
Sequence:CCGGGCAAGGATTTACAACCAGATACTCGAGTATCTGGTTGTAAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-495s1c1
Sequence:CCGGCCAGCTTGCATCATCCTACTTCTCGAGAAGTAGGATGATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1634s1c1
Sequence:CCGGCCATGCGTATCTGCTTTCAAACTCGAGTTTGAAAGCAGATACGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019967
BRINP1 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-2912s21c1
Sequence:CCGGACGTGTTCTAGCGACTGTATACTCGAGTATACAGTCGCTAGAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-1786s21c1
Sequence:CCGGATAAGGGCTACAAGCTGTATACTCGAGTATACAGCTTGTAGCCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-541s21c1
Sequence:CCGGAGGAATTTGATTGGCTTATTTCTCGAGAAATAAGCCAATCAAATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-3172s21c1
Sequence:CCGGGAGGAAATGGACGTAGATAAACTCGAGTTTATCTACGTCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1520s1c1
Sequence:CCGGGCAATGAGATTCGCCTGGATACTCGAGTATCCAGGCGAATCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1278s1c1
Sequence:CCGGCCCATGTATCATAGGTGGGAACTCGAGTTCCCACCTATGATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-186s1c1
Sequence:CCGGGCAAGGATTTACAACCAGATACTCGAGTATCTGGTTGTAAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-495s1c1
Sequence:CCGGCCAGCTTGCATCATCCTACTTCTCGAGAAGTAGGATGATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1634s1c1
Sequence:CCGGCCATGCGTATCTGCTTTCAAACTCGAGTTTGAAAGCAGATACGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019967
BRINP1 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-2912s21c1
Sequence:CCGGACGTGTTCTAGCGACTGTATACTCGAGTATACAGTCGCTAGAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-1786s21c1
Sequence:CCGGATAAGGGCTACAAGCTGTATACTCGAGTATACAGCTTGTAGCCCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019967.2-541s21c1
Sequence:CCGGAGGAATTTGATTGGCTTATTTCTCGAGAAATAAGCCAATCAAATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019967.2-3172s21c1
Sequence:CCGGGAGGAAATGGACGTAGATAAACTCGAGTTTATCTACGTCCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1520s1c1
Sequence:CCGGGCAATGAGATTCGCCTGGATACTCGAGTATCCAGGCGAATCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1278s1c1
Sequence:CCGGCCCATGTATCATAGGTGGGAACTCGAGTTCCCACCTATGATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-186s1c1
Sequence:CCGGGCAAGGATTTACAACCAGATACTCGAGTATCTGGTTGTAAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-495s1c1
Sequence:CCGGCCAGCTTGCATCATCCTACTTCTCGAGAAGTAGGATGATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019967.1-1634s1c1
Sequence:CCGGCCATGCGTATCTGCTTTCAAACTCGAGTTTGAAAGCAGATACGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014618
BRINP1 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014618.2-2895s21c1
Sequence:CCGGACGTTCTAGCAACTGTATAAACTCGAGTTTATACAGTTGCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-2329s1c1
Sequence:CCGGCTACCTACCCTACTGCGAAATCTCGAGATTTCGCAGTAGGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-1186s1c1
Sequence:CCGGCAGTCGGCCTTGAGCTATATCCTCGAGGATATAGCTCAAGGCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-953s21c1
Sequence:CCGGAGCTCGCATCATCCTACTTTGCTCGAGCAAAGTAGGATGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-2534s21c1
Sequence:CCGGTGCTCCTCTTGTTGGATATTCCTCGAGGAATATCCAACAAGAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-1082s1c1
Sequence:CCGGGAGAGCAAACTGCACCTTCAACTCGAGTTGAAGGTGCAGTTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-603s1c1
Sequence:CCGGGTCAAGGATTTACAACCAGATCTCGAGATCTGGTTGTAAATCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-2740s1c1
Sequence:CCGGGTACACACACAACAGAACAAACTCGAGTTTGTTCTGTTGTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014618
BRINP1 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014618.2-2895s21c1
Sequence:CCGGACGTTCTAGCAACTGTATAAACTCGAGTTTATACAGTTGCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-2329s1c1
Sequence:CCGGCTACCTACCCTACTGCGAAATCTCGAGATTTCGCAGTAGGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-1186s1c1
Sequence:CCGGCAGTCGGCCTTGAGCTATATCCTCGAGGATATAGCTCAAGGCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-953s21c1
Sequence:CCGGAGCTCGCATCATCCTACTTTGCTCGAGCAAAGTAGGATGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-2534s21c1
Sequence:CCGGTGCTCCTCTTGTTGGATATTCCTCGAGGAATATCCAACAAGAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-1082s1c1
Sequence:CCGGGAGAGCAAACTGCACCTTCAACTCGAGTTGAAGGTGCAGTTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-603s1c1
Sequence:CCGGGTCAAGGATTTACAACCAGATCTCGAGATCTGGTTGTAAATCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-2740s1c1
Sequence:CCGGGTACACACACAACAGAACAAACTCGAGTTTGTTCTGTTGTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014618
BRINP1 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein/retinoic acid inducible neural-specific 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014618.2-2895s21c1
Sequence:CCGGACGTTCTAGCAACTGTATAAACTCGAGTTTATACAGTTGCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-2329s1c1
Sequence:CCGGCTACCTACCCTACTGCGAAATCTCGAGATTTCGCAGTAGGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.2-1186s1c1
Sequence:CCGGCAGTCGGCCTTGAGCTATATCCTCGAGGATATAGCTCAAGGCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-953s21c1
Sequence:CCGGAGCTCGCATCATCCTACTTTGCTCGAGCAAAGTAGGATGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014618.2-2534s21c1
Sequence:CCGGTGCTCCTCTTGTTGGATATTCCTCGAGGAATATCCAACAAGAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-1082s1c1
Sequence:CCGGGAGAGCAAACTGCACCTTCAACTCGAGTTGAAGGTGCAGTTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-603s1c1
Sequence:CCGGGTCAAGGATTTACAACCAGATCTCGAGATCTGGTTGTAAATCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014618.1-2740s1c1
Sequence:CCGGGTACACACACAACAGAACAAACTCGAGTTTGTTCTGTTGTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks