EMAIL THIS PAGE TO A FRIEND

BRINP2

bone morphogenetic protein/retinoic acid inducible neural-specific 2

106 Gene Product Result for
Synonyms: DBCCR1L2 FAM5B RP5-1026E2.1
Gene ID:
Mouse(240843) bone morphogenic protein/retinoic acid inducible neural-specific 2
Rat(286895) bone morphogenetic protein/retinoic acid inducible neural-specific 2
Zebrafish(561009) bone morphogenic protein/retinoic acid inducible neural-specific 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125911 MISSION® esiRNA esiRNA human FAM5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021165 Rosetta Predictions human pricing
NM_173115 Rosetta Predictions rat pricing
NM_207583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059028 predicted 1103
2 SASI_Hs01_00059029 predicted 520
3 SASI_Hs01_00059030 predicted 1878
4 SASI_Hs01_00059031 predicted 1177
5 SASI_Hs01_00059032 predicted 2317
6 SASI_Hs01_00059033 predicted 1303
7 SASI_Hs01_00059034 predicted 1292
8 SASI_Hs01_00059035 predicted 2265
9 SASI_Hs01_00059036 predicted 1591
10 SASI_Hs01_00059037 predicted 2302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087546 predicted 2313
2 SASI_Rn01_00087547 predicted 1191
3 SASI_Rn01_00087548 predicted 2326
4 SASI_Rn01_00087549 predicted 3208
5 SASI_Rn01_00087550 predicted 2117
6 SASI_Rn01_00087551 predicted 3273
7 SASI_Rn02_00269270 predicted 2899
8 SASI_Rn01_00087552 predicted 3260
9 SASI_Rn01_00087553 predicted 1394
10 SASI_Rn01_00087554 predicted 1878
11 SASI_Rn01_00087555 predicted 3195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093542 predicted 3276
2 SASI_Mm01_00093543 predicted 2313
3 SASI_Mm01_00093544 predicted 2330
4 SASI_Mm01_00093545 predicted 1321
5 SASI_Mm01_00093546 predicted 3082
6 SASI_Mm02_00352128 predicted 1753
7 SASI_Mm01_00093548 predicted 1873
8 SASI_Mm01_00093549 predicted 1376
9 SASI_Mm01_00093550 predicted 3199
10 SASI_Mm01_00093551 predicted 3193
11 SASI_Mm01_00093547 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021165
BRINP2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-1064s1c1
Sequence:CCGGCCAGAGAACAAAGTACAGTTACTCGAGTAACTGTACTTTGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-3153s1c1
Sequence:CCGGCCTGACATTGGTTCTTACTTTCTCGAGAAAGTAAGAACCAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-2962s1c1
Sequence:CCGGGCCAAGGAAGAGATTAAGAAACTCGAGTTTCTTAATCTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-2231s1c1
Sequence:CCGGGAGACAGTTCATGTTTACCTACTCGAGTAGGTAAACATGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021165.1-3392s1c1
Sequence:CCGGCGAAGAAAGAAGCTCTGTCAACTCGAGTTGACAGAGCTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-659s21c1
Sequence:CCGGCAGAGTTTATCCGGAACATTCCTCGAGGAATGTTCCGGATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2351s21c1
Sequence:CCGGTTAACACCTTGCAGGTCTTTGCTCGAGCAAAGACCTGCAAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2393s21c1
Sequence:CCGGCAGATGCTATCCGGGACTTAACTCGAGTTAAGTCCCGGATAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2418s21c1
Sequence:CCGGCCAGTTGGACTACCCATATACCTCGAGGTATATGGGTAGTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021165
BRINP2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-1064s1c1
Sequence:CCGGCCAGAGAACAAAGTACAGTTACTCGAGTAACTGTACTTTGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-3153s1c1
Sequence:CCGGCCTGACATTGGTTCTTACTTTCTCGAGAAAGTAAGAACCAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-2962s1c1
Sequence:CCGGGCCAAGGAAGAGATTAAGAAACTCGAGTTTCTTAATCTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-2231s1c1
Sequence:CCGGGAGACAGTTCATGTTTACCTACTCGAGTAGGTAAACATGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021165.1-3392s1c1
Sequence:CCGGCGAAGAAAGAAGCTCTGTCAACTCGAGTTGACAGAGCTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-659s21c1
Sequence:CCGGCAGAGTTTATCCGGAACATTCCTCGAGGAATGTTCCGGATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2351s21c1
Sequence:CCGGTTAACACCTTGCAGGTCTTTGCTCGAGCAAAGACCTGCAAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2393s21c1
Sequence:CCGGCAGATGCTATCCGGGACTTAACTCGAGTTAAGTCCCGGATAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2418s21c1
Sequence:CCGGCCAGTTGGACTACCCATATACCTCGAGGTATATGGGTAGTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021165
BRINP2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-1064s1c1
Sequence:CCGGCCAGAGAACAAAGTACAGTTACTCGAGTAACTGTACTTTGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-3153s1c1
Sequence:CCGGCCTGACATTGGTTCTTACTTTCTCGAGAAAGTAAGAACCAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021165.1-2962s1c1
Sequence:CCGGGCCAAGGAAGAGATTAAGAAACTCGAGTTTCTTAATCTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021165.1-2231s1c1
Sequence:CCGGGAGACAGTTCATGTTTACCTACTCGAGTAGGTAAACATGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021165.1-3392s1c1
Sequence:CCGGCGAAGAAAGAAGCTCTGTCAACTCGAGTTGACAGAGCTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-659s21c1
Sequence:CCGGCAGAGTTTATCCGGAACATTCCTCGAGGAATGTTCCGGATAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2351s21c1
Sequence:CCGGTTAACACCTTGCAGGTCTTTGCTCGAGCAAAGACCTGCAAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2393s21c1
Sequence:CCGGCAGATGCTATCCGGGACTTAACTCGAGTTAAGTCCCGGATAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021165.2-2418s21c1
Sequence:CCGGCCAGTTGGACTACCCATATACCTCGAGGTATATGGGTAGTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207583
BRINP2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207583.1-3548s1c1
Sequence:CCGGGCTGGCTAAATCAGGAAAGAACTCGAGTTCTTTCCTGATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2695s1c1
Sequence:CCGGGCCTGTTAATGAGGGCAACTTCTCGAGAAGTTGCCCTCATTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1165s1c1
Sequence:CCGGCCGATGGAAAGTGAACAACTTCTCGAGAAGTTGTTCACTTTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2966s1c1
Sequence:CCGGCCGGATGCTATCCGAGATTTACTCGAGTAAATCTCGGATAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1817s1c1
Sequence:CCGGGCTGACATTCAGGCTATGGAACTCGAGTTCCATAGCCTGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207583
BRINP2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207583.1-3548s1c1
Sequence:CCGGGCTGGCTAAATCAGGAAAGAACTCGAGTTCTTTCCTGATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2695s1c1
Sequence:CCGGGCCTGTTAATGAGGGCAACTTCTCGAGAAGTTGCCCTCATTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1165s1c1
Sequence:CCGGCCGATGGAAAGTGAACAACTTCTCGAGAAGTTGTTCACTTTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2966s1c1
Sequence:CCGGCCGGATGCTATCCGAGATTTACTCGAGTAAATCTCGGATAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1817s1c1
Sequence:CCGGGCTGACATTCAGGCTATGGAACTCGAGTTCCATAGCCTGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207583
BRINP2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein/retinoic acid inducible neural-specific 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207583.1-3548s1c1
Sequence:CCGGGCTGGCTAAATCAGGAAAGAACTCGAGTTCTTTCCTGATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2695s1c1
Sequence:CCGGGCCTGTTAATGAGGGCAACTTCTCGAGAAGTTGCCCTCATTAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1165s1c1
Sequence:CCGGCCGATGGAAAGTGAACAACTTCTCGAGAAGTTGTTCACTTTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-2966s1c1
Sequence:CCGGCCGGATGCTATCCGAGATTTACTCGAGTAAATCTCGGATAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207583.1-1817s1c1
Sequence:CCGGGCTGACATTCAGGCTATGGAACTCGAGTTCCATAGCCTGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks