EMAIL THIS PAGE TO A FRIEND

BRIP1

BRCA1 interacting protein C-terminal helicase 1

159 Gene Product Result for
Synonyms: BACH1 FANCJ OF
UniProtKB ID: Q9BX63, Q3MJE2, Q8NCI5
Gene ID:
Human(83990) Summary: The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]
Mouse(237911) BRCA1 interacting protein C-terminal helicase 1
Rat(360588) BRCA1 interacting protein C-terminal helicase 1
domestic guinea pig(100729812) BRCA1 interacting protein C-terminal helicase 1
naked mole-rat(101716733) BRCA1 interacting protein C-terminal helicase 1
sheep(101107879) BRCA1 interacting protein C-terminal helicase 1
Zebrafish(794038) BRCA1 interacting protein C-terminal helicase 1
dog(491122) BRCA1 interacting protein C-terminal helicase 1
cow(783256) BRCA1 interacting protein C-terminal helicase 1
domestic cat(101091321) BRCA1 interacting protein C-terminal helicase 1
chicken(417642) BRCA1 interacting protein C-terminal helicase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032043 Rosetta Predictions human pricing
XM_001081096 Rosetta Predictions rat pricing
XM_340869 Rosetta Predictions rat pricing
NM_178309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229728 predicted 1515
2 SASI_Hs01_00229729 predicted 2601
3 SASI_Hs01_00229730 predicted 250
4 SASI_Hs02_00359243 predicted 1803
5 SASI_Hs01_00229731 predicted 902
6 SASI_Hs01_00229733 predicted 818
7 SASI_Hs01_00229734 predicted 1173
8 SASI_Hs01_00229735 predicted 2259
9 SASI_Hs02_00359244 predicted 2862
10 SASI_Hs01_00229737 predicted 1241
11 SASI_Hs01_00229732 predicted 1299
12 SASI_Hs01_00229736 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370578 predicted 1607
2 SASI_Rn02_00370579 predicted 3074
3 SASI_Rn02_00370580 predicted 1589
4 SASI_Rn02_00370581 predicted 197
5 SASI_Rn02_00370582 predicted 2163
6 SASI_Rn02_00370583 predicted 388
7 SASI_Rn02_00370584 predicted 737
8 SASI_Rn02_00370585 predicted 622
9 SASI_Rn02_00370586 predicted 1599
10 SASI_Rn02_00370587 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392040 predicted 1605
2 SASI_Rn02_00392041 predicted 3073
3 SASI_Rn02_00392042 predicted 1587
4 SASI_Rn02_00392043 predicted 1230
5 SASI_Rn02_00392044 predicted 2162
6 SASI_Rn02_00392045 predicted 2466
7 SASI_Rn02_00392046 predicted 1599
8 SASI_Rn02_00392047 predicted 1658
9 SASI_Rn02_00392048 predicted 2532
10 SASI_Rn02_00392049 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136066 predicted 422
2 SASI_Mm01_00136067 predicted 1161
3 SASI_Mm01_00136068 predicted 1946
4 SASI_Mm01_00136069 predicted 1705
5 SASI_Mm01_00136070 predicted 2204
6 SASI_Mm01_00136071 predicted 1784
7 SASI_Mm01_00136072 predicted 3363
8 SASI_Mm01_00136073 predicted 1641
9 SASI_Mm01_00136075 predicted 1337
10 SASI_Mm02_00348737 predicted 1172
11 SASI_Mm01_00136074 predicted 1799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032043
VALIDATED
BRIP1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 interacting protein C-terminal helicase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-2693s21c1
Sequence:CCGGATAACCCAAGTCGCTATATATCTCGAGATATATAGCGACTTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-1179s21c1
Sequence:CCGGACTAAAGGCCTGTCCATATTACTCGAGTAATATGGACAGGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-3344s21c1
Sequence:CCGGCTCAATCAGAAACCATTATTTCTCGAGAAATAATGGTTTCTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-559s1c1
Sequence:CCGGGCTAAGAAACAGGCATCCATACTCGAGTATGGATGCCTGTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2662s1c1
Sequence:CCGGGCTCTTATTCTAGTGGATGATCTCGAGATCATCCACTAGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2012s1c1
Sequence:CCGGCGTCAGAACTTGGTGTTACATCTCGAGATGTAACACCAAGTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-444s1c1
Sequence:CCGGCCAAGGAACTTCACGTCATTTCTCGAGAAATGACGTGAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-3541s1c1
Sequence:CCGGCCTGAACTTTACGATCCTGAACTCGAGTTCAGGATCGTAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032043
VALIDATED
BRIP1 MISSION shRNA shRNA Plasmid DNA
BRCA1 interacting protein C-terminal helicase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-2693s21c1
Sequence:CCGGATAACCCAAGTCGCTATATATCTCGAGATATATAGCGACTTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-1179s21c1
Sequence:CCGGACTAAAGGCCTGTCCATATTACTCGAGTAATATGGACAGGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-3344s21c1
Sequence:CCGGCTCAATCAGAAACCATTATTTCTCGAGAAATAATGGTTTCTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-559s1c1
Sequence:CCGGGCTAAGAAACAGGCATCCATACTCGAGTATGGATGCCTGTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2662s1c1
Sequence:CCGGGCTCTTATTCTAGTGGATGATCTCGAGATCATCCACTAGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2012s1c1
Sequence:CCGGCGTCAGAACTTGGTGTTACATCTCGAGATGTAACACCAAGTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-444s1c1
Sequence:CCGGCCAAGGAACTTCACGTCATTTCTCGAGAAATGACGTGAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-3541s1c1
Sequence:CCGGCCTGAACTTTACGATCCTGAACTCGAGTTCAGGATCGTAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032043
VALIDATED
BRIP1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 interacting protein C-terminal helicase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-2693s21c1
Sequence:CCGGATAACCCAAGTCGCTATATATCTCGAGATATATAGCGACTTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-1179s21c1
Sequence:CCGGACTAAAGGCCTGTCCATATTACTCGAGTAATATGGACAGGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032043.1-3344s21c1
Sequence:CCGGCTCAATCAGAAACCATTATTTCTCGAGAAATAATGGTTTCTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-559s1c1
Sequence:CCGGGCTAAGAAACAGGCATCCATACTCGAGTATGGATGCCTGTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2662s1c1
Sequence:CCGGGCTCTTATTCTAGTGGATGATCTCGAGATCATCCACTAGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-2012s1c1
Sequence:CCGGCGTCAGAACTTGGTGTTACATCTCGAGATGTAACACCAAGTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-444s1c1
Sequence:CCGGCCAAGGAACTTCACGTCATTTCTCGAGAAATGACGTGAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032043.1-3541s1c1
Sequence:CCGGCCTGAACTTTACGATCCTGAACTCGAGTTCAGGATCGTAAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178309
VALIDATED
BRIP1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 interacting protein C-terminal helicase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-809s1c1
Sequence:CCGGGCCTGCAAATACTGTTAAGAACTCGAGTTCTTAACAGTATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-419s1c1
Sequence:CCGGCCTGGACACTTCACCTCATTTCTCGAGAAATGAGGTGAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178309.1-3156s1c1
Sequence:CCGGCGGCATTTCAATAGTAAAGTACTCGAGTACTTTACTATTGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-1435s1c1
Sequence:CCGGCCCTACGAGATGTGTGCTATACTCGAGTATAGCACACATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-2457s1c1
Sequence:CCGGGCTGTCATAACCGTAGGGATTCTCGAGAATCCCTACGGTTATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178309
VALIDATED
BRIP1 MISSION shRNA shRNA Plasmid DNA
BRCA1 interacting protein C-terminal helicase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-809s1c1
Sequence:CCGGGCCTGCAAATACTGTTAAGAACTCGAGTTCTTAACAGTATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-419s1c1
Sequence:CCGGCCTGGACACTTCACCTCATTTCTCGAGAAATGAGGTGAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178309.1-3156s1c1
Sequence:CCGGCGGCATTTCAATAGTAAAGTACTCGAGTACTTTACTATTGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-1435s1c1
Sequence:CCGGCCCTACGAGATGTGTGCTATACTCGAGTATAGCACACATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-2457s1c1
Sequence:CCGGGCTGTCATAACCGTAGGGATTCTCGAGAATCCCTACGGTTATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178309
VALIDATED
BRIP1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 interacting protein C-terminal helicase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-809s1c1
Sequence:CCGGGCCTGCAAATACTGTTAAGAACTCGAGTTCTTAACAGTATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-419s1c1
Sequence:CCGGCCTGGACACTTCACCTCATTTCTCGAGAAATGAGGTGAAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178309.1-3156s1c1
Sequence:CCGGCGGCATTTCAATAGTAAAGTACTCGAGTACTTTACTATTGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-1435s1c1
Sequence:CCGGCCCTACGAGATGTGTGCTATACTCGAGTATAGCACACATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178309.1-2457s1c1
Sequence:CCGGGCTGTCATAACCGTAGGGATTCTCGAGAATCCCTACGGTTATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks