EMAIL THIS PAGE TO A FRIEND

BRIX1

BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)

56 Gene Product Result for
Synonyms: BRIX BXDC2
UniProtKB ID: Q8TDN6, A8K0P5, Q3ZTT4, Q8N453, Q96DH1
Gene ID:
Mouse(67832) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Rat(294799) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
chicken(427433) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
domestic cat(101080262) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
cow(518501) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Horse(100053899) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
dog(479365) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
sheep(101112163) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
naked mole-rat(101716372) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
domestic guinea pig(100714575) BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018321 Rosetta Predictions human pricing
NM_001029915 Rosetta Predictions rat pricing
NM_026396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016107 predicted 657
2 SASI_Hs01_00016108 predicted 543
3 SASI_Hs01_00016109 predicted 613
4 SASI_Hs01_00016110 predicted 619
5 SASI_Hs01_00016112 predicted 246
6 SASI_Hs01_00016114 predicted 389
7 SASI_Hs01_00016115 predicted 807
8 SASI_Hs01_00016116 predicted 309
9 SASI_Hs02_00351751 predicted 307
10 SASI_Hs02_00351752 predicted 264
11 SASI_Hs01_00016111 predicted 637
12 SASI_Hs01_00016113 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068573 predicted 702
2 SASI_Rn01_00068574 predicted 219
3 SASI_Rn01_00068575 predicted 610
4 SASI_Rn01_00068576 predicted 1063
5 SASI_Rn01_00068577 predicted 1089
6 SASI_Rn01_00068578 predicted 226
7 SASI_Rn01_00068579 predicted 223
8 SASI_Rn02_00203481 predicted 844
9 SASI_Rn01_00068580 predicted 865
10 SASI_Rn01_00068582 predicted 244
11 SASI_Rn01_00068581 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330167 predicted 847
2 SASI_Mm02_00330168 predicted 981
3 SASI_Mm01_00055147 predicted 502
4 SASI_Mm02_00330169 predicted 566
5 SASI_Mm02_00330170 predicted 1173
6 SASI_Mm01_00055149 predicted 826
7 SASI_Mm02_00330171 predicted 660
8 SASI_Mm02_00330172 predicted 654
9 SASI_Mm02_00330173 predicted 1073
10 SASI_Mm01_00055150 predicted 289
11 SASI_Mm01_00055142 predicted 536
12 SASI_Mm01_00055143 predicted 783
13 SASI_Mm01_00055144 predicted 275
14 SASI_Mm01_00055145 predicted 356
15 SASI_Mm01_00055146 predicted 546
16 SASI_Mm01_00055148 predicted 754
17 SASI_Mm01_00055151 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018321
BRIX1 MISSION shRNA Bacterial Glycerol Stock
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-883s1c1
Sequence:CCGGCCGAAGACTCTTCTTCCACATCTCGAGATGTGGAAGAAGAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-413s1c1
Sequence:CCGGCTGCTAAATTCCTTGTTCAAACTCGAGTTTGAACAAGGAATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-609s1c1
Sequence:CCGGCCACGTGTTTACTTTCACCATCTCGAGATGGTGAAAGTAAACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-598s1c1
Sequence:CCGGCCATTTGTGGACCACGTGTTTCTCGAGAAACACGTGGTCCACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-392s1c1
Sequence:CCGGCAAATTCACCTCACGGACCATCTCGAGATGGTCCGTGAGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-844s1c1
Sequence:CCGGCAAGTGAAAGATGTGCCGCAACTCGAGTTGCGGCACATCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-150s1c1
Sequence:CCGGCGTTTGCAAGGGAAAGTGGAACTCGAGTTCCACTTTCCCTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-934s1c1
Sequence:CCGGGCTGAGGAGAAACCAATAGAACTCGAGTTCTATTGGTTTCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-561s1c1
Sequence:CCGGGATCTTTAGTACACCACGGTACTCGAGTACCGTGGTGTACTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-234s1c1
Sequence:CCGGGCAGGACTTGAGAATGTTGATCTCGAGATCAACATTCTCAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-384s1c1
Sequence:CCGGGTGGCTTTCAAATTCACCTCACTCGAGTGAGGTGAATTTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-224s1c1
Sequence:CCGGGACATTTAATGCAGGACTTGACTCGAGTCAAGTCCTGCATTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-312s1c1
Sequence:CCGGCGAGGTTTGTGAAATGAAGAACTCGAGTTCTTCATTTCACAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018321
BRIX1 MISSION shRNA shRNA Plasmid DNA
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-883s1c1
Sequence:CCGGCCGAAGACTCTTCTTCCACATCTCGAGATGTGGAAGAAGAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-413s1c1
Sequence:CCGGCTGCTAAATTCCTTGTTCAAACTCGAGTTTGAACAAGGAATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-609s1c1
Sequence:CCGGCCACGTGTTTACTTTCACCATCTCGAGATGGTGAAAGTAAACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-598s1c1
Sequence:CCGGCCATTTGTGGACCACGTGTTTCTCGAGAAACACGTGGTCCACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-392s1c1
Sequence:CCGGCAAATTCACCTCACGGACCATCTCGAGATGGTCCGTGAGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-844s1c1
Sequence:CCGGCAAGTGAAAGATGTGCCGCAACTCGAGTTGCGGCACATCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-150s1c1
Sequence:CCGGCGTTTGCAAGGGAAAGTGGAACTCGAGTTCCACTTTCCCTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-934s1c1
Sequence:CCGGGCTGAGGAGAAACCAATAGAACTCGAGTTCTATTGGTTTCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-561s1c1
Sequence:CCGGGATCTTTAGTACACCACGGTACTCGAGTACCGTGGTGTACTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-234s1c1
Sequence:CCGGGCAGGACTTGAGAATGTTGATCTCGAGATCAACATTCTCAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-384s1c1
Sequence:CCGGGTGGCTTTCAAATTCACCTCACTCGAGTGAGGTGAATTTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-224s1c1
Sequence:CCGGGACATTTAATGCAGGACTTGACTCGAGTCAAGTCCTGCATTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-312s1c1
Sequence:CCGGCGAGGTTTGTGAAATGAAGAACTCGAGTTCTTCATTTCACAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018321
BRIX1 MISSION shRNA Lentiviral Transduction Particles
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-883s1c1
Sequence:CCGGCCGAAGACTCTTCTTCCACATCTCGAGATGTGGAAGAAGAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-413s1c1
Sequence:CCGGCTGCTAAATTCCTTGTTCAAACTCGAGTTTGAACAAGGAATTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-609s1c1
Sequence:CCGGCCACGTGTTTACTTTCACCATCTCGAGATGGTGAAAGTAAACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-598s1c1
Sequence:CCGGCCATTTGTGGACCACGTGTTTCTCGAGAAACACGTGGTCCACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-392s1c1
Sequence:CCGGCAAATTCACCTCACGGACCATCTCGAGATGGTCCGTGAGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-844s1c1
Sequence:CCGGCAAGTGAAAGATGTGCCGCAACTCGAGTTGCGGCACATCTTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-150s1c1
Sequence:CCGGCGTTTGCAAGGGAAAGTGGAACTCGAGTTCCACTTTCCCTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-934s1c1
Sequence:CCGGGCTGAGGAGAAACCAATAGAACTCGAGTTCTATTGGTTTCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-561s1c1
Sequence:CCGGGATCTTTAGTACACCACGGTACTCGAGTACCGTGGTGTACTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-234s1c1
Sequence:CCGGGCAGGACTTGAGAATGTTGATCTCGAGATCAACATTCTCAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-384s1c1
Sequence:CCGGGTGGCTTTCAAATTCACCTCACTCGAGTGAGGTGAATTTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018321.2-224s1c1
Sequence:CCGGGACATTTAATGCAGGACTTGACTCGAGTCAAGTCCTGCATTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018321.2-312s1c1
Sequence:CCGGCGAGGTTTGTGAAATGAAGAACTCGAGTTCTTCATTTCACAAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026396
VALIDATED
BRIX1 MISSION shRNA Bacterial Glycerol Stock
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-924s1c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-754s1c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-813s1c1
Sequence:CCGGCGTGTCATAAGATCCATCACACTCGAGTGTGATGGATCTTATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-318s1c1
Sequence:CCGGGTGATAAATGAGGTCTGTGAACTCGAGTTCACAGACCTCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-462s1c1
Sequence:CCGGGCTGAATTAAAGATGACTGGACTCGAGTCCAGTCATCTTTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-954s21c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-694s21c1
Sequence:CCGGTCCGGAACTTCCAGATTATAGCTCGAGCTATAATCTGGAAGTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1034s21c1
Sequence:CCGGAGCAAGGAAGAGACGGATTTACTCGAGTAAATCCGTCTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1162s21c1
Sequence:CCGGAGAACGAGCTATGCCTAATTACTCGAGTAATTAGGCATAGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-784s21c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026396
VALIDATED
BRIX1 MISSION shRNA shRNA Plasmid DNA
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-924s1c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-754s1c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-813s1c1
Sequence:CCGGCGTGTCATAAGATCCATCACACTCGAGTGTGATGGATCTTATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-318s1c1
Sequence:CCGGGTGATAAATGAGGTCTGTGAACTCGAGTTCACAGACCTCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-462s1c1
Sequence:CCGGGCTGAATTAAAGATGACTGGACTCGAGTCCAGTCATCTTTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-954s21c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-694s21c1
Sequence:CCGGTCCGGAACTTCCAGATTATAGCTCGAGCTATAATCTGGAAGTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1034s21c1
Sequence:CCGGAGCAAGGAAGAGACGGATTTACTCGAGTAAATCCGTCTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1162s21c1
Sequence:CCGGAGAACGAGCTATGCCTAATTACTCGAGTAATTAGGCATAGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-784s21c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026396
VALIDATED
BRIX1 MISSION shRNA Lentiviral Transduction Particles
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-924s1c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-754s1c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-813s1c1
Sequence:CCGGCGTGTCATAAGATCCATCACACTCGAGTGTGATGGATCTTATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-318s1c1
Sequence:CCGGGTGATAAATGAGGTCTGTGAACTCGAGTTCACAGACCTCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026396.2-462s1c1
Sequence:CCGGGCTGAATTAAAGATGACTGGACTCGAGTCCAGTCATCTTTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-954s21c1
Sequence:CCGGGCAGACGTGTTTGTTATACCACTCGAGTGGTATAACAAACACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-694s21c1
Sequence:CCGGTCCGGAACTTCCAGATTATAGCTCGAGCTATAATCTGGAAGTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1034s21c1
Sequence:CCGGAGCAAGGAAGAGACGGATTTACTCGAGTAAATCCGTCTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-1162s21c1
Sequence:CCGGAGAACGAGCTATGCCTAATTACTCGAGTAATTAGGCATAGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026396.3-784s21c1
Sequence:CCGGGCTTTGGAGGACCAACCTTATCTCGAGATAAGGTTGGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks