EMAIL THIS PAGE TO A FRIEND

BRK1

BRICK1, SCAR/WAVE actin-nucleating complex subunit

112 Gene Product Result for
Synonyms: C3orf10 MDS027 hHBrk1
UniProtKB ID: Q8WUW1, B2R5E2, Q9P082
Gene ID:
Mouse(101314) BRICK1, SCAR/WAVE actin-nucleating complex subunit
Rat(679934) BRICK1, SCAR/WAVE actin-nucleating complex subunit
Thale Cress(816795) protein BRICK 1
cow(540092) BRICK1, SCAR/WAVE actin-nucleating complex subunit
domestic guinea pig(100717524) BRICK1, SCAR/WAVE actin-nucleating complex subunit
naked mole-rat(101706890) BRICK1, SCAR/WAVE actin-nucleating complex subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060391 Anti-BRK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4301207 Anti-BRK1 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
AV51212 Anti-C3ORF10 antibody produced in rabbit IgG fraction of antiserum bovine, rat, mouse, zebrafish, human, horse, canine
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018462 Rosetta Predictions human pricing
XM_001055004 Rosetta Predictions rat pricing
NM_133937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208363 predicted 232
2 SASI_Hs01_00208364 predicted 731
3 SASI_Hs01_00208365 predicted 568
4 SASI_Hs01_00208368 predicted 294
5 SASI_Hs01_00208369 predicted 590
6 SASI_Hs01_00208370 predicted 705
7 SASI_Hs01_00208371 predicted 478
8 SASI_Hs01_00208372 predicted 749
9 SASI_Hs02_00352021 predicted 733
10 SASI_Hs02_00352022 predicted 298
11 SASI_Hs01_00208366 predicted 525
12 SASI_Hs01_00208367 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278035 predicted 241
2 SASI_Rn02_00278036 predicted 568
3 SASI_Rn02_00278037 predicted 496
4 SASI_Rn02_00278038 predicted 276
5 SASI_Rn02_00278039 predicted 383
6 SASI_Rn02_00278040 predicted 717
7 SASI_Rn02_00278041 predicted 676
8 SASI_Rn02_00278042 predicted 537
9 SASI_Rn02_00278043 predicted 497
10 SASI_Rn02_00278044 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028244 predicted 615
2 SASI_Mm01_00028245 predicted 698
3 SASI_Mm01_00028246 predicted 589
4 SASI_Mm01_00028247 predicted 715
5 SASI_Mm01_00028249 predicted 706
6 SASI_Mm01_00028250 predicted 136
7 SASI_Mm01_00028251 predicted 108
8 SASI_Mm01_00028252 predicted 471
9 SASI_Mm01_00028253 predicted 170
10 SASI_Mm02_00339037 predicted 476
11 SASI_Mm01_00028248 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133937
BRK1 MISSION shRNA Bacterial Glycerol Stock
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-58s21c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133937.1-486s21c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-148s21c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-182s21c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-58s1c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-148s1c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-182s1c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-179s1c1
Sequence:CCGGGAACGGAGAATAGAGTACATTCTCGAGAATGTACTCTATTCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133937.1-486s1c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133937
BRK1 MISSION shRNA shRNA Plasmid DNA
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-58s21c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133937.1-486s21c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-148s21c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-182s21c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-58s1c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-148s1c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-182s1c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-179s1c1
Sequence:CCGGGAACGGAGAATAGAGTACATTCTCGAGAATGTACTCTATTCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133937.1-486s1c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133937
BRK1 MISSION shRNA Lentiviral Transduction Particles
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-58s21c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133937.1-486s21c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-148s21c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133937.1-182s21c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-58s1c1
Sequence:CCGGGAACCGGGAGTACATTGAGATCTCGAGATCTCAATGTACTCCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-148s1c1
Sequence:CCGGCGCAACACTAAATGAGAAATTCTCGAGAATTTCTCATTTAGTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-182s1c1
Sequence:CCGGCGGAGAATAGAGTACATTGAACTCGAGTTCAATGTACTCTATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133937.1-179s1c1
Sequence:CCGGGAACGGAGAATAGAGTACATTCTCGAGAATGTACTCTATTCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133937.1-486s1c1
Sequence:CCGGGAACTACTTGTCAATGTGTTTCTCGAGAAACACATTGACAAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018462
VALIDATED
BRK1 MISSION shRNA Bacterial Glycerol Stock
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-157s1c1
Sequence:CCGGGACTTGCAACACTAAACGAGACTCGAGTCTCGTTTAGTGTTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-145s1c1
Sequence:CCGGCTTGTCGTTCAAGACTTGCAACTCGAGTTGCAAGTCTTGAACGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-137s1c1
Sequence:CCGGCGATATGTCTTGTCGTTCAAGCTCGAGCTTGAACGACAAGACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-133s1c1
Sequence:CCGGCGTTCGATATGTCTTGTCGTTCTCGAGAACGACAAGACATATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-89s1c1
Sequence:CCGGGATAATCACCAGCAGCATCAACTCGAGTTGATGCTGCTGGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-151s1c1
Sequence:CCGGGTTCAAGACTTGCAACACTAACTCGAGTTAGTGTTGCAAGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-199s1c1
Sequence:CCGGGAATAGAGTACATTGAAGCTCCTCGAGGAGCTTCAATGTACTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-120s1c1
Sequence:CCGGGACTTTCTCAACTCGTTCGATCTCGAGATCGAACGAGTTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-174s1c1
Sequence:CCGGGAGAAATTGACAGCCCTTGAACTCGAGTTCAAGGGCTGTCAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018462
VALIDATED
BRK1 MISSION shRNA shRNA Plasmid DNA
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-157s1c1
Sequence:CCGGGACTTGCAACACTAAACGAGACTCGAGTCTCGTTTAGTGTTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-145s1c1
Sequence:CCGGCTTGTCGTTCAAGACTTGCAACTCGAGTTGCAAGTCTTGAACGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-137s1c1
Sequence:CCGGCGATATGTCTTGTCGTTCAAGCTCGAGCTTGAACGACAAGACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-133s1c1
Sequence:CCGGCGTTCGATATGTCTTGTCGTTCTCGAGAACGACAAGACATATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-89s1c1
Sequence:CCGGGATAATCACCAGCAGCATCAACTCGAGTTGATGCTGCTGGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-151s1c1
Sequence:CCGGGTTCAAGACTTGCAACACTAACTCGAGTTAGTGTTGCAAGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-199s1c1
Sequence:CCGGGAATAGAGTACATTGAAGCTCCTCGAGGAGCTTCAATGTACTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-120s1c1
Sequence:CCGGGACTTTCTCAACTCGTTCGATCTCGAGATCGAACGAGTTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-174s1c1
Sequence:CCGGGAGAAATTGACAGCCCTTGAACTCGAGTTCAAGGGCTGTCAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018462
VALIDATED
BRK1 MISSION shRNA Lentiviral Transduction Particles
BRICK1, SCAR/WAVE actin-nucleating complex subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-157s1c1
Sequence:CCGGGACTTGCAACACTAAACGAGACTCGAGTCTCGTTTAGTGTTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-145s1c1
Sequence:CCGGCTTGTCGTTCAAGACTTGCAACTCGAGTTGCAAGTCTTGAACGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-137s1c1
Sequence:CCGGCGATATGTCTTGTCGTTCAAGCTCGAGCTTGAACGACAAGACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-133s1c1
Sequence:CCGGCGTTCGATATGTCTTGTCGTTCTCGAGAACGACAAGACATATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018462.3-89s1c1
Sequence:CCGGGATAATCACCAGCAGCATCAACTCGAGTTGATGCTGCTGGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-151s1c1
Sequence:CCGGGTTCAAGACTTGCAACACTAACTCGAGTTAGTGTTGCAAGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018462.3-199s1c1
Sequence:CCGGGAATAGAGTACATTGAAGCTCCTCGAGGAGCTTCAATGTACTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-120s1c1
Sequence:CCGGGACTTTCTCAACTCGTTCGATCTCGAGATCGAACGAGTTGAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018462.3-174s1c1
Sequence:CCGGGAGAAATTGACAGCCCTTGAACTCGAGTTCAAGGGCTGTCAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks