EMAIL THIS PAGE TO A FRIEND

BRMS1

breast cancer metastasis suppressor 1

87 Gene Product Result for
UniProtKB ID: Q9HCU9, Q6IAI2
Gene ID:
Human(25855) Summary: This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(107392) breast cancer metastasis-suppressor 1
Rat(293668) breast cancer metastasis-suppressor 1
Zebrafish(791681) breast cancer metastasis-suppressor 1
domestic cat(101084317) breast cancer metastasis suppressor 1
cow(615952) breast cancer metastasis suppressor 1
dog(611920) breast cancer metastasis suppressor 1
naked mole-rat(101725052) breast cancer metastasis suppressor 1
domestic guinea pig(100728792) breast cancer metastasis suppressor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015399 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004591 MISSION® esiRNA esiRNA targeting human BRMS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024957 Rosetta Predictions human pricing
NM_001024958 Rosetta Predictions human pricing
NM_015399 Rosetta Predictions human pricing
NM_001009605 Rosetta Predictions rat pricing
NM_134155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307294 predicted 285
2 SASI_Hs02_00307295 predicted 633
3 SASI_Hs02_00307296 predicted 277
4 SASI_Hs02_00307297 predicted 485
5 SASI_Hs02_00307298 predicted 361
6 SASI_Hs02_00307299 predicted 1108
7 SASI_Hs02_00307300 predicted 366
8 SASI_Hs02_00307301 predicted 1206
9 SASI_Hs02_00307302 predicted 1195
10 SASI_Hs02_00307303 predicted 770
11 SASI_Hs01_00193723 predicted 318
12 SASI_Hs01_00193724 predicted 316
13 SASI_Hs01_00193725 predicted 284
14 SASI_Hs01_00193726 predicted 337
15 SASI_Hs01_00193727 predicted 315
16 SASI_Hs01_00193728 predicted 334
17 SASI_Hs01_00193729 predicted 313
18 SASI_Hs01_00193730 predicted 252
19 SASI_Hs01_00193731 predicted 281
20 SASI_Hs01_00193732 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138724 predicted 325
2 SASI_Hs01_00138725 predicted 320
3 SASI_Hs01_00138726 predicted 285
4 SASI_Hs01_00138727 predicted 329
5 SASI_Hs01_00138728 predicted 317
6 SASI_Hs01_00138729 predicted 328
7 SASI_Hs01_00138730 predicted 314
8 SASI_Hs01_00138731 predicted 284
9 SASI_Hs01_00138732 predicted 243
10 SASI_Hs01_00138733 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347759 predicted 277
2 SASI_Hs02_00347760 predicted 634
3 SASI_Hs02_00347761 predicted 274
4 SASI_Hs02_00347762 predicted 488
5 SASI_Hs02_00347763 predicted 354
6 SASI_Hs02_00347764 predicted 1182
7 SASI_Hs02_00347765 predicted 366
8 SASI_Hs02_00347766 predicted 1285
9 SASI_Hs02_00347767 predicted 1274
10 SASI_Hs02_00347768 predicted 771
11 SASI_Hs01_00185078 predicted 325
12 SASI_Hs01_00185079 predicted 317
13 SASI_Hs01_00185080 predicted 279
14 SASI_Hs01_00185081 predicted 334
15 SASI_Hs01_00185082 predicted 313
16 SASI_Hs01_00185083 predicted 328
17 SASI_Hs01_00185084 predicted 314
18 SASI_Hs01_00185085 predicted 251
19 SASI_Hs01_00185086 predicted 285
20 SASI_Hs01_00185087 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115386 predicted 961
2 SASI_Rn01_00115387 predicted 683
3 SASI_Rn01_00115388 predicted 408
4 SASI_Rn01_00115389 predicted 399
5 SASI_Rn01_00115391 predicted 241
6 SASI_Rn01_00115392 predicted 381
7 SASI_Rn01_00115393 predicted 592
8 SASI_Rn02_00199617 predicted 845
9 SASI_Rn01_00115394 predicted 222
10 SASI_Rn01_00115395 predicted 996
11 SASI_Rn01_00115390 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193870 predicted 886
2 SASI_Mm01_00193871 predicted 479
3 SASI_Mm01_00193872 predicted 987
4 SASI_Mm01_00193873 predicted 273
5 SASI_Mm01_00193874 predicted 538
6 SASI_Mm01_00193875 predicted 1030
7 SASI_Mm01_00193876 predicted 867
8 SASI_Mm01_00193877 predicted 257
9 SASI_Mm02_00339420 predicted 869
10 SASI_Mm01_00193878 predicted 396
11 SASI_Mm01_00193879 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134155
VALIDATED
BRMS1 MISSION shRNA Bacterial Glycerol Stock
breast cancer metastasis suppressor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-639s1c1
Sequence:CCGGACGACAAACTACATAGCAGAACTCGAGTTCTGCTATGTAGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-712s1c1
Sequence:CCGGGCTCGTTTCTGGTCCATACATCTCGAGATGTATGGACCAGAAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134155.1-389s1c1
Sequence:CCGGCCAGAATATACGGAACCTCTTCTCGAGAAGAGGTTCCGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-485s1c1
Sequence:CCGGAGGAATAAGTATGAGTGTGAACTCGAGTTCACACTCATACTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-1072s1c1
Sequence:CCGGCCTCCCAAAGAATAACTTCTTCTCGAGAAGAAGTTATTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134155
VALIDATED
BRMS1 MISSION shRNA shRNA Plasmid DNA
breast cancer metastasis suppressor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-639s1c1
Sequence:CCGGACGACAAACTACATAGCAGAACTCGAGTTCTGCTATGTAGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-712s1c1
Sequence:CCGGGCTCGTTTCTGGTCCATACATCTCGAGATGTATGGACCAGAAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134155.1-389s1c1
Sequence:CCGGCCAGAATATACGGAACCTCTTCTCGAGAAGAGGTTCCGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-485s1c1
Sequence:CCGGAGGAATAAGTATGAGTGTGAACTCGAGTTCACACTCATACTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-1072s1c1
Sequence:CCGGCCTCCCAAAGAATAACTTCTTCTCGAGAAGAAGTTATTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134155
VALIDATED
BRMS1 MISSION shRNA Lentiviral Transduction Particles
breast cancer metastasis suppressor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-639s1c1
Sequence:CCGGACGACAAACTACATAGCAGAACTCGAGTTCTGCTATGTAGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-712s1c1
Sequence:CCGGGCTCGTTTCTGGTCCATACATCTCGAGATGTATGGACCAGAAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134155.1-389s1c1
Sequence:CCGGCCAGAATATACGGAACCTCTTCTCGAGAAGAGGTTCCGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-485s1c1
Sequence:CCGGAGGAATAAGTATGAGTGTGAACTCGAGTTCACACTCATACTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134155.1-1072s1c1
Sequence:CCGGCCTCCCAAAGAATAACTTCTTCTCGAGAAGAAGTTATTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015399
BRMS1 MISSION shRNA Bacterial Glycerol Stock
breast cancer metastasis suppressor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-449s1c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-334s1c1
Sequence:CCGGCTCGGAGCTAAAGGAGAAGTTCTCGAGAACTTCTCCTTTAGCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-259s1c1
Sequence:CCGGCGAGATGGATGATGAGGACTACTCGAGTAGTCCTCATCATCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-325s1c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-475s21c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-351s21c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-778s21c1
Sequence:CCGGCCATACATCGTGTACATGCTTCTCGAGAAGCATGTACACGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-680s21c1
Sequence:CCGGCTGAATGGTGGGATGACAAACCTCGAGGTTTGTCATCCCACCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015399.3-1191s21c1
Sequence:CCGGAGAAGACAGCCGAAGTCAAAGCTCGAGCTTTGACTTCGGCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015399
BRMS1 MISSION shRNA shRNA Plasmid DNA
breast cancer metastasis suppressor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-449s1c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-334s1c1
Sequence:CCGGCTCGGAGCTAAAGGAGAAGTTCTCGAGAACTTCTCCTTTAGCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-259s1c1
Sequence:CCGGCGAGATGGATGATGAGGACTACTCGAGTAGTCCTCATCATCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-325s1c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-475s21c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-351s21c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-778s21c1
Sequence:CCGGCCATACATCGTGTACATGCTTCTCGAGAAGCATGTACACGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-680s21c1
Sequence:CCGGCTGAATGGTGGGATGACAAACCTCGAGGTTTGTCATCCCACCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015399.3-1191s21c1
Sequence:CCGGAGAAGACAGCCGAAGTCAAAGCTCGAGCTTTGACTTCGGCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015399
BRMS1 MISSION shRNA Lentiviral Transduction Particles
breast cancer metastasis suppressor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-449s1c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-334s1c1
Sequence:CCGGCTCGGAGCTAAAGGAGAAGTTCTCGAGAACTTCTCCTTTAGCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-259s1c1
Sequence:CCGGCGAGATGGATGATGAGGACTACTCGAGTAGTCCTCATCATCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015399.2-325s1c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-475s21c1
Sequence:CCGGCGGAGCCTCAAGATTCGCATTCTCGAGAATGCGAATCTTGAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-351s21c1
Sequence:CCGGGAAGCAGTTCTCGGAGCTAAACTCGAGTTTAGCTCCGAGAACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-778s21c1
Sequence:CCGGCCATACATCGTGTACATGCTTCTCGAGAAGCATGTACACGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015399.3-680s21c1
Sequence:CCGGCTGAATGGTGGGATGACAAACCTCGAGGTTTGTCATCCCACCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015399.3-1191s21c1
Sequence:CCGGAGAAGACAGCCGAAGTCAAAGCTCGAGCTTTGACTTCGGCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks